Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636677_s_at:

>probe:Drosophila_2:1636677_s_at:614:69; Interrogation_Position=472; Antisense; AGGCCATCGATCACGCAAAGATACT
>probe:Drosophila_2:1636677_s_at:496:171; Interrogation_Position=488; Antisense; AAAGATACTCGATTGCGCCAAGCCG
>probe:Drosophila_2:1636677_s_at:475:301; Interrogation_Position=527; Antisense; CCCTCTGCCAATAAGCCTCATAATT
>probe:Drosophila_2:1636677_s_at:109:313; Interrogation_Position=541; Antisense; GCCTCATAATTGAAAGTCCACGCTC
>probe:Drosophila_2:1636677_s_at:448:505; Interrogation_Position=556; Antisense; GTCCACGCTCAACTTGGCTGAATGA
>probe:Drosophila_2:1636677_s_at:535:631; Interrogation_Position=592; Antisense; TCCTGCACAGAGATCGAGTCGGCGA
>probe:Drosophila_2:1636677_s_at:400:625; Interrogation_Position=623; Antisense; TGCGCCGCCGCTGGACAAGAGCAAG
>probe:Drosophila_2:1636677_s_at:107:281; Interrogation_Position=672; Antisense; CTCATCGTCATTCGGCGGCGCAAGA
>probe:Drosophila_2:1636677_s_at:468:421; Interrogation_Position=780; Antisense; GAGAAGGCCTTCCAAGCAAAGCTGA
>probe:Drosophila_2:1636677_s_at:429:605; Interrogation_Position=802; Antisense; TGATATCCCAGATCAAGCAGGCGGA
>probe:Drosophila_2:1636677_s_at:442:273; Interrogation_Position=829; Antisense; CATTCAGTGCGGAGCAGCACGTGGC
>probe:Drosophila_2:1636677_s_at:465:97; Interrogation_Position=856; Antisense; AGATCCTGCGGCAGGCCAACGAGAC
>probe:Drosophila_2:1636677_s_at:303:477; Interrogation_Position=892; Antisense; GTTTCTGGAAGGGACGCCGCCTGCC
>probe:Drosophila_2:1636677_s_at:97:301; Interrogation_Position=909; Antisense; CGCCTGCCGGCATTTATCATTAAGC

Paste this into a BLAST search page for me
AGGCCATCGATCACGCAAAGATACTAAAGATACTCGATTGCGCCAAGCCGCCCTCTGCCAATAAGCCTCATAATTGCCTCATAATTGAAAGTCCACGCTCGTCCACGCTCAACTTGGCTGAATGATCCTGCACAGAGATCGAGTCGGCGATGCGCCGCCGCTGGACAAGAGCAAGCTCATCGTCATTCGGCGGCGCAAGAGAGAAGGCCTTCCAAGCAAAGCTGATGATATCCCAGATCAAGCAGGCGGACATTCAGTGCGGAGCAGCACGTGGCAGATCCTGCGGCAGGCCAACGAGACGTTTCTGGAAGGGACGCCGCCTGCCCGCCTGCCGGCATTTATCATTAAGC

Full Affymetrix probeset data:

Annotations for 1636677_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime