FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636678_at:

>probe:Drosophila_2:1636678_at:188:337; Interrogation_Position=126; Antisense; GCTCCAGCAGGCCTTGAATGACAAC
>probe:Drosophila_2:1636678_at:371:645; Interrogation_Position=203; Antisense; TCACGGGAGCAGAGGCCAAATCCTT
>probe:Drosophila_2:1636678_at:62:621; Interrogation_Position=231; Antisense; TGCTCTTCGAGTTTTCGATGCCTGG
>probe:Drosophila_2:1636678_at:581:393; Interrogation_Position=257; Antisense; GAAAGTTCCCGCAAGGACTGCTCTA
>probe:Drosophila_2:1636678_at:313:619; Interrogation_Position=275; Antisense; TGCTCTACGGCCACTTTATGGACAT
>probe:Drosophila_2:1636678_at:488:431; Interrogation_Position=339; Antisense; GAGTCTGGGCAATGTCATGACCATC
>probe:Drosophila_2:1636678_at:717:53; Interrogation_Position=355; Antisense; ATGACCATCAATGCCGGAGCCAAGT
>probe:Drosophila_2:1636678_at:505:99; Interrogation_Position=404; Antisense; AGAGTTTGCTCATGGAAGCCGCCGG
>probe:Drosophila_2:1636678_at:429:517; Interrogation_Position=43; Antisense; GTGGGAGTACTAACCACTGCCCAGA
>probe:Drosophila_2:1636678_at:164:99; Interrogation_Position=432; Antisense; AGATGCCCTCACCTTGAGTATTGGA
>probe:Drosophila_2:1636678_at:534:429; Interrogation_Position=447; Antisense; GAGTATTGGAACCTGCATACCCTCA
>probe:Drosophila_2:1636678_at:359:645; Interrogation_Position=574; Antisense; TCTTTGGCGCACAGAGATCCCATGA
>probe:Drosophila_2:1636678_at:371:103; Interrogation_Position=65; Antisense; AGACGTACAGCTCCAAGGACCTGTT
>probe:Drosophila_2:1636678_at:217:547; Interrogation_Position=95; Antisense; GGATGCAGTCCAGCAACTTCGGCTA

Paste this into a BLAST search page for me
GCTCCAGCAGGCCTTGAATGACAACTCACGGGAGCAGAGGCCAAATCCTTTGCTCTTCGAGTTTTCGATGCCTGGGAAAGTTCCCGCAAGGACTGCTCTATGCTCTACGGCCACTTTATGGACATGAGTCTGGGCAATGTCATGACCATCATGACCATCAATGCCGGAGCCAAGTAGAGTTTGCTCATGGAAGCCGCCGGGTGGGAGTACTAACCACTGCCCAGAAGATGCCCTCACCTTGAGTATTGGAGAGTATTGGAACCTGCATACCCTCATCTTTGGCGCACAGAGATCCCATGAAGACGTACAGCTCCAAGGACCTGTTGGATGCAGTCCAGCAACTTCGGCTA

Full Affymetrix probeset data:

Annotations for 1636678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720