Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636679_at:

>probe:Drosophila_2:1636679_at:535:63; Interrogation_Position=5079; Antisense; ATGTGGACTTCGACGCGGATAGCTT
>probe:Drosophila_2:1636679_at:592:329; Interrogation_Position=5093; Antisense; GCGGATAGCTTTGTGGCCCAACTGA
>probe:Drosophila_2:1636679_at:430:195; Interrogation_Position=5112; Antisense; AACTGAGTCAGCACGTCACTGGAAA
>probe:Drosophila_2:1636679_at:51:367; Interrogation_Position=5174; Antisense; GAATCCTCGTCGTCGGCGGTGAATA
>probe:Drosophila_2:1636679_at:330:615; Interrogation_Position=5193; Antisense; TGAATAGTCACTTTGGGAGCCACAG
>probe:Drosophila_2:1636679_at:592:553; Interrogation_Position=5208; Antisense; GGAGCCACAGCACACCAATGGATTG
>probe:Drosophila_2:1636679_at:439:191; Interrogation_Position=5255; Antisense; AACTCTTTTATGCAGGCGGTGACCC
>probe:Drosophila_2:1636679_at:562:347; Interrogation_Position=5284; Antisense; GCAGGCGGGCCAACACGTCGAATAC
>probe:Drosophila_2:1636679_at:535:241; Interrogation_Position=5304; Antisense; AATACGCGACGTCGACGAGCATGGC
>probe:Drosophila_2:1636679_at:313:267; Interrogation_Position=5376; Antisense; CAGTGGACGCCTTCAATGCTAGTGG
>probe:Drosophila_2:1636679_at:448:521; Interrogation_Position=5397; Antisense; GTGGCGATATATTCGATCTGTTCAA
>probe:Drosophila_2:1636679_at:619:265; Interrogation_Position=5463; Antisense; CAGTCTAGGCGGTTTTATGTATTCA
>probe:Drosophila_2:1636679_at:371:59; Interrogation_Position=5479; Antisense; ATGTATTCATATGGCCCTCAAAGCG
>probe:Drosophila_2:1636679_at:174:717; Interrogation_Position=5539; Antisense; TTCCCAACTTTGTTCCGTATCGAGA

Paste this into a BLAST search page for me
ATGTGGACTTCGACGCGGATAGCTTGCGGATAGCTTTGTGGCCCAACTGAAACTGAGTCAGCACGTCACTGGAAAGAATCCTCGTCGTCGGCGGTGAATATGAATAGTCACTTTGGGAGCCACAGGGAGCCACAGCACACCAATGGATTGAACTCTTTTATGCAGGCGGTGACCCGCAGGCGGGCCAACACGTCGAATACAATACGCGACGTCGACGAGCATGGCCAGTGGACGCCTTCAATGCTAGTGGGTGGCGATATATTCGATCTGTTCAACAGTCTAGGCGGTTTTATGTATTCAATGTATTCATATGGCCCTCAAAGCGTTCCCAACTTTGTTCCGTATCGAGA

Full Affymetrix probeset data:

Annotations for 1636679_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime