FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636681_at:

>probe:Drosophila_2:1636681_at:703:19; Interrogation_Position=1040; Antisense; ATTTGTGATCGCAGTATCGCTCCTA
>probe:Drosophila_2:1636681_at:344:91; Interrogation_Position=1052; Antisense; AGTATCGCTCCTAATCCTGGGCAAC
>probe:Drosophila_2:1636681_at:396:595; Interrogation_Position=1118; Antisense; TGTGGGTGTGCTCTGCTACAATCGC
>probe:Drosophila_2:1636681_at:431:625; Interrogation_Position=1180; Antisense; TGCCGCTGTCGCAGACTAGCTATGT
>probe:Drosophila_2:1636681_at:664:145; Interrogation_Position=1194; Antisense; ACTAGCTATGTCAAGTACTCGCCGC
>probe:Drosophila_2:1636681_at:110:217; Interrogation_Position=1206; Antisense; AAGTACTCGCCGCTGGAGCAACAGG
>probe:Drosophila_2:1636681_at:198:355; Interrogation_Position=1223; Antisense; GCAACAGGCAGATCCGTACTACCGG
>probe:Drosophila_2:1636681_at:183:41; Interrogation_Position=1250; Antisense; ATCGGTCAACGGGAAGCTATCCAAT
>probe:Drosophila_2:1636681_at:684:337; Interrogation_Position=1265; Antisense; GCTATCCAATGGCTTGCACAGAACG
>probe:Drosophila_2:1636681_at:715:107; Interrogation_Position=1284; Antisense; AGAACGCCCGGAAACAGTCTGCTGG
>probe:Drosophila_2:1636681_at:237:565; Interrogation_Position=1337; Antisense; GGCAACGCGGCTACTATTTGTTTAG
>probe:Drosophila_2:1636681_at:5:25; Interrogation_Position=1402; Antisense; ATAGTATTAACCTGTGACGACCACC
>probe:Drosophila_2:1636681_at:330:403; Interrogation_Position=1438; Antisense; GACTCTCCCCTCTTTTATATATATA
>probe:Drosophila_2:1636681_at:526:711; Interrogation_Position=978; Antisense; TTCAGCGTCTTGTCTCTGGTGACTC

Paste this into a BLAST search page for me
ATTTGTGATCGCAGTATCGCTCCTAAGTATCGCTCCTAATCCTGGGCAACTGTGGGTGTGCTCTGCTACAATCGCTGCCGCTGTCGCAGACTAGCTATGTACTAGCTATGTCAAGTACTCGCCGCAAGTACTCGCCGCTGGAGCAACAGGGCAACAGGCAGATCCGTACTACCGGATCGGTCAACGGGAAGCTATCCAATGCTATCCAATGGCTTGCACAGAACGAGAACGCCCGGAAACAGTCTGCTGGGGCAACGCGGCTACTATTTGTTTAGATAGTATTAACCTGTGACGACCACCGACTCTCCCCTCTTTTATATATATATTCAGCGTCTTGTCTCTGGTGACTC

Full Affymetrix probeset data:

Annotations for 1636681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720