FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636682_at:

>probe:Drosophila_2:1636682_at:396:461; Interrogation_Position=546; Antisense; GATTTTGGCCGTTATCCTGGAACAA
>probe:Drosophila_2:1636682_at:158:387; Interrogation_Position=565; Antisense; GAACAACCATTCACTGCAGAGGCGG
>probe:Drosophila_2:1636682_at:689:329; Interrogation_Position=586; Antisense; GCGGTTGTTCGAGATGCATGCCAGA
>probe:Drosophila_2:1636682_at:527:53; Interrogation_Position=599; Antisense; ATGCATGCCAGACGGCGCCGAATAA
>probe:Drosophila_2:1636682_at:448:595; Interrogation_Position=627; Antisense; TGTGTGGCTATGTAGCCCATCTACC
>probe:Drosophila_2:1636682_at:186:645; Interrogation_Position=646; Antisense; TCTACCCTGGGCATATTTTTCGATC
>probe:Drosophila_2:1636682_at:619:695; Interrogation_Position=663; Antisense; TTTCGATCCGGAGACACAACGTTGT
>probe:Drosophila_2:1636682_at:433:253; Interrogation_Position=679; Antisense; CAACGTTGTCGCTACATGGGATGCA
>probe:Drosophila_2:1636682_at:666:293; Interrogation_Position=709; Antisense; CGAAAGCTGTTCTTAACCCTTGAAG
>probe:Drosophila_2:1636682_at:691:95; Interrogation_Position=743; Antisense; AGATTTGCAACAATCCGCGGCACAT
>probe:Drosophila_2:1636682_at:49:325; Interrogation_Position=771; Antisense; GCGACGCAACCAAGCAAAGGCCAAT
>probe:Drosophila_2:1636682_at:303:671; Interrogation_Position=833; Antisense; TACCCTTAGTTGTTAATTGTCACGT
>probe:Drosophila_2:1636682_at:636:493; Interrogation_Position=851; Antisense; GTCACGTGCCTTATTTAGTCGAATG
>probe:Drosophila_2:1636682_at:69:683; Interrogation_Position=952; Antisense; TATACGCACATCAAACTGGTTTTTA

Paste this into a BLAST search page for me
GATTTTGGCCGTTATCCTGGAACAAGAACAACCATTCACTGCAGAGGCGGGCGGTTGTTCGAGATGCATGCCAGAATGCATGCCAGACGGCGCCGAATAATGTGTGGCTATGTAGCCCATCTACCTCTACCCTGGGCATATTTTTCGATCTTTCGATCCGGAGACACAACGTTGTCAACGTTGTCGCTACATGGGATGCACGAAAGCTGTTCTTAACCCTTGAAGAGATTTGCAACAATCCGCGGCACATGCGACGCAACCAAGCAAAGGCCAATTACCCTTAGTTGTTAATTGTCACGTGTCACGTGCCTTATTTAGTCGAATGTATACGCACATCAAACTGGTTTTTA

Full Affymetrix probeset data:

Annotations for 1636682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720