FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636683_at:

>probe:Drosophila_2:1636683_at:257:213; Interrogation_Position=100; Antisense; AAGATCCTAAGGCACTTCATGAAGA
>probe:Drosophila_2:1636683_at:175:617; Interrogation_Position=140; Antisense; TGCAGTGCGTGGACATCTATGAGAA
>probe:Drosophila_2:1636683_at:89:325; Interrogation_Position=167; Antisense; GCGCAGAGTTTCTTGTGGAGCACCC
>probe:Drosophila_2:1636683_at:711:385; Interrogation_Position=18; Antisense; GAACATGAAACTTTGCGAGGCGGAA
>probe:Drosophila_2:1636683_at:623:583; Interrogation_Position=182; Antisense; TGGAGCACCCGAAGTACGAGTCCTG
>probe:Drosophila_2:1636683_at:410:83; Interrogation_Position=194; Antisense; AGTACGAGTCCTGCCACTTTGAAGT
>probe:Drosophila_2:1636683_at:614:691; Interrogation_Position=211; Antisense; TTTGAAGTCCTGGTCCGACTCGGAT
>probe:Drosophila_2:1636683_at:260:377; Interrogation_Position=249; Antisense; GAAGCAGCGTCTATTTTATCGATTA
>probe:Drosophila_2:1636683_at:2:181; Interrogation_Position=273; Antisense; AAACAATGCTGATCCCATTTCCATC
>probe:Drosophila_2:1636683_at:177:499; Interrogation_Position=329; Antisense; GTCTCAGTGAGGTGGCCGAGTCATT
>probe:Drosophila_2:1636683_at:484:497; Interrogation_Position=348; Antisense; GTCATTCAGCGCCTTCAAGGAATCT
>probe:Drosophila_2:1636683_at:646:563; Interrogation_Position=366; Antisense; GGAATCTATCACAGAGACCCGAATG
>probe:Drosophila_2:1636683_at:277:79; Interrogation_Position=43; Antisense; AGGATATACGCGCTCTCGAACAGTG
>probe:Drosophila_2:1636683_at:109:111; Interrogation_Position=73; Antisense; AGAATCCTGGATGACGCGGAGGCCC

Paste this into a BLAST search page for me
AAGATCCTAAGGCACTTCATGAAGATGCAGTGCGTGGACATCTATGAGAAGCGCAGAGTTTCTTGTGGAGCACCCGAACATGAAACTTTGCGAGGCGGAATGGAGCACCCGAAGTACGAGTCCTGAGTACGAGTCCTGCCACTTTGAAGTTTTGAAGTCCTGGTCCGACTCGGATGAAGCAGCGTCTATTTTATCGATTAAAACAATGCTGATCCCATTTCCATCGTCTCAGTGAGGTGGCCGAGTCATTGTCATTCAGCGCCTTCAAGGAATCTGGAATCTATCACAGAGACCCGAATGAGGATATACGCGCTCTCGAACAGTGAGAATCCTGGATGACGCGGAGGCCC

Full Affymetrix probeset data:

Annotations for 1636683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720