FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636684_at:

>probe:Drosophila_2:1636684_at:300:161; Interrogation_Position=122; Antisense; ACAATGTCCCCAAGCGGTCGGAGTC
>probe:Drosophila_2:1636684_at:118:549; Interrogation_Position=141; Antisense; GGAGTCCCACTTCCGTGTGTTCGTC
>probe:Drosophila_2:1636684_at:288:513; Interrogation_Position=157; Antisense; GTGTTCGTCGTCTCGGAGAAGTTCA
>probe:Drosophila_2:1636684_at:551:473; Interrogation_Position=177; Antisense; GTTCAACGATCTGACGCTCATCAAG
>probe:Drosophila_2:1636684_at:396:339; Interrogation_Position=192; Antisense; GCTCATCAAGCGTCATCGATTGGTT
>probe:Drosophila_2:1636684_at:507:75; Interrogation_Position=20; Antisense; AGGAGGCGGGACAGTATCCGCCCAT
>probe:Drosophila_2:1636684_at:168:43; Interrogation_Position=206; Antisense; ATCGATTGGTTAATGACACGGTAAA
>probe:Drosophila_2:1636684_at:436:377; Interrogation_Position=244; Antisense; GAAGCAGGCTTCGAGTTTATGCACG
>probe:Drosophila_2:1636684_at:335:699; Interrogation_Position=259; Antisense; TTTATGCACGCCCTGTCCATTGAGG
>probe:Drosophila_2:1636684_at:621:5; Interrogation_Position=277; Antisense; ATTGAGGCCAAGACACCCAAGCAGT
>probe:Drosophila_2:1636684_at:84:125; Interrogation_Position=317; Antisense; AGCCGGAGAAGAGTCCGCCGTGCCT
>probe:Drosophila_2:1636684_at:418:321; Interrogation_Position=39; Antisense; GCCCATCGAGTCTGCCATGCGAAAA
>probe:Drosophila_2:1636684_at:22:209; Interrogation_Position=62; Antisense; AAGCACTAAACACGGAGCTGAAGCC
>probe:Drosophila_2:1636684_at:384:547; Interrogation_Position=96; Antisense; GGAGGTCATTAACGAATCGCCCCAG

Paste this into a BLAST search page for me
ACAATGTCCCCAAGCGGTCGGAGTCGGAGTCCCACTTCCGTGTGTTCGTCGTGTTCGTCGTCTCGGAGAAGTTCAGTTCAACGATCTGACGCTCATCAAGGCTCATCAAGCGTCATCGATTGGTTAGGAGGCGGGACAGTATCCGCCCATATCGATTGGTTAATGACACGGTAAAGAAGCAGGCTTCGAGTTTATGCACGTTTATGCACGCCCTGTCCATTGAGGATTGAGGCCAAGACACCCAAGCAGTAGCCGGAGAAGAGTCCGCCGTGCCTGCCCATCGAGTCTGCCATGCGAAAAAAGCACTAAACACGGAGCTGAAGCCGGAGGTCATTAACGAATCGCCCCAG

Full Affymetrix probeset data:

Annotations for 1636684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720