FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636687_at:

>probe:Drosophila_2:1636687_at:487:367; Interrogation_Position=116; Antisense; GAATCGCCAGCATGGGTCAGCGGAC
>probe:Drosophila_2:1636687_at:484:121; Interrogation_Position=134; Antisense; AGCGGACGCCAAATCTGAGTTTTCG
>probe:Drosophila_2:1636687_at:596:189; Interrogation_Position=244; Antisense; AACATCAAGATTTCGGTTGCCTCCG
>probe:Drosophila_2:1636687_at:475:55; Interrogation_Position=293; Antisense; ATGAGTTTCGGACTCCCAAGGTGAC
>probe:Drosophila_2:1636687_at:137:223; Interrogation_Position=310; Antisense; AAGGTGACGCTGCTGGACGATCTCA
>probe:Drosophila_2:1636687_at:313:587; Interrogation_Position=323; Antisense; TGGACGATCTCAGCGACGATGTCAA
>probe:Drosophila_2:1636687_at:481:137; Interrogation_Position=338; Antisense; ACGATGTCAACTCCTCGACGGATGA
>probe:Drosophila_2:1636687_at:181:669; Interrogation_Position=400; Antisense; TACGAGGGAACCACCATCAACAATG
>probe:Drosophila_2:1636687_at:3:309; Interrogation_Position=455; Antisense; CCATTGGGCTGGATGATGGCCTTCT
>probe:Drosophila_2:1636687_at:125:69; Interrogation_Position=470; Antisense; ATGGCCTTCTGGATAACGATGGTGA
>probe:Drosophila_2:1636687_at:636:87; Interrogation_Position=544; Antisense; AGTCTCGGAGGGATCTACATTGGTC
>probe:Drosophila_2:1636687_at:318:451; Interrogation_Position=555; Antisense; GATCTACATTGGTCCCAGGCATTGA
>probe:Drosophila_2:1636687_at:178:535; Interrogation_Position=63; Antisense; GGTGCTAAATGTGCCGCCCACGTTG
>probe:Drosophila_2:1636687_at:253:139; Interrogation_Position=82; Antisense; ACGTTGAGCATGTCGCACACCCAGA

Paste this into a BLAST search page for me
GAATCGCCAGCATGGGTCAGCGGACAGCGGACGCCAAATCTGAGTTTTCGAACATCAAGATTTCGGTTGCCTCCGATGAGTTTCGGACTCCCAAGGTGACAAGGTGACGCTGCTGGACGATCTCATGGACGATCTCAGCGACGATGTCAAACGATGTCAACTCCTCGACGGATGATACGAGGGAACCACCATCAACAATGCCATTGGGCTGGATGATGGCCTTCTATGGCCTTCTGGATAACGATGGTGAAGTCTCGGAGGGATCTACATTGGTCGATCTACATTGGTCCCAGGCATTGAGGTGCTAAATGTGCCGCCCACGTTGACGTTGAGCATGTCGCACACCCAGA

Full Affymetrix probeset data:

Annotations for 1636687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720