Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636688_at:

>probe:Drosophila_2:1636688_at:11:681; Interrogation_Position=1706; Antisense; TAGGGCACCATCATGTCTAGATTAG
>probe:Drosophila_2:1636688_at:137:191; Interrogation_Position=1761; Antisense; AACATTTCCAGCGTAGTGACGCAGT
>probe:Drosophila_2:1636688_at:529:509; Interrogation_Position=1776; Antisense; GTGACGCAGTTTGAAAGGCCCAGCT
>probe:Drosophila_2:1636688_at:352:321; Interrogation_Position=1805; Antisense; GCCCATTTCTTATCACTTACAACAT
>probe:Drosophila_2:1636688_at:204:535; Interrogation_Position=1940; Antisense; GGTGCTGGGCTTTATTTGTGGTTAA
>probe:Drosophila_2:1636688_at:37:519; Interrogation_Position=1957; Antisense; GTGGTTAACATCCAGAGCCAGCTAA
>probe:Drosophila_2:1636688_at:173:483; Interrogation_Position=2050; Antisense; GTATTTTGGATGTACGCCGATCTCC
>probe:Drosophila_2:1636688_at:532:317; Interrogation_Position=2065; Antisense; GCCGATCTCCTTTTACAAACTACAT
>probe:Drosophila_2:1636688_at:416:665; Interrogation_Position=2095; Antisense; TACACATACTTATTGCTCTCCAGAG
>probe:Drosophila_2:1636688_at:443:707; Interrogation_Position=2126; Antisense; TTAATCCAAAACTCTCCGTCGTCCG
>probe:Drosophila_2:1636688_at:310:639; Interrogation_Position=2154; Antisense; TCGTGTTCCCTGACAATTCCTTAAA
>probe:Drosophila_2:1636688_at:92:665; Interrogation_Position=2170; Antisense; TTCCTTAAACTACCGATCCCAATAG
>probe:Drosophila_2:1636688_at:141:451; Interrogation_Position=2194; Antisense; GATCTGAACTTAGGACCACTTCTTG
>probe:Drosophila_2:1636688_at:376:555; Interrogation_Position=2206; Antisense; GGACCACTTCTTGCTGTCATACAAT

Paste this into a BLAST search page for me
TAGGGCACCATCATGTCTAGATTAGAACATTTCCAGCGTAGTGACGCAGTGTGACGCAGTTTGAAAGGCCCAGCTGCCCATTTCTTATCACTTACAACATGGTGCTGGGCTTTATTTGTGGTTAAGTGGTTAACATCCAGAGCCAGCTAAGTATTTTGGATGTACGCCGATCTCCGCCGATCTCCTTTTACAAACTACATTACACATACTTATTGCTCTCCAGAGTTAATCCAAAACTCTCCGTCGTCCGTCGTGTTCCCTGACAATTCCTTAAATTCCTTAAACTACCGATCCCAATAGGATCTGAACTTAGGACCACTTCTTGGGACCACTTCTTGCTGTCATACAAT

Full Affymetrix probeset data:

Annotations for 1636688_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime