FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636689_at:

>probe:Drosophila_2:1636689_at:213:69; Interrogation_Position=380; Antisense; ATGGCGTTACTCATTCTGGTATCCG
>probe:Drosophila_2:1636689_at:438:483; Interrogation_Position=398; Antisense; GTATCCGCATTTGAGATGACAGCCA
>probe:Drosophila_2:1636689_at:699:687; Interrogation_Position=503; Antisense; TATTTGAACTCGACGGACTACCCCA
>probe:Drosophila_2:1636689_at:275:141; Interrogation_Position=539; Antisense; ACGGTCCAGGTCGATCTTTTGAGCA
>probe:Drosophila_2:1636689_at:475:61; Interrogation_Position=569; Antisense; ATGTGTAGCTCTCGAAAGCTGCCCA
>probe:Drosophila_2:1636689_at:378:207; Interrogation_Position=584; Antisense; AAGCTGCCCATCCAGCAAATCTGTG
>probe:Drosophila_2:1636689_at:197:337; Interrogation_Position=650; Antisense; GCTCCTCTGGTTTGTCGGATACTTA
>probe:Drosophila_2:1636689_at:488:139; Interrogation_Position=711; Antisense; ACTGGTTAAGTCAAAAGCCTGTCGA
>probe:Drosophila_2:1636689_at:614:385; Interrogation_Position=734; Antisense; GAAAATACATTCATCGTCTTTACGA
>probe:Drosophila_2:1636689_at:567:705; Interrogation_Position=753; Antisense; TTACGAATGTAGCTGGTCTGCTCCC
>probe:Drosophila_2:1636689_at:338:337; Interrogation_Position=772; Antisense; GCTCCCTTGGATTGACTACCATTTA
>probe:Drosophila_2:1636689_at:3:377; Interrogation_Position=803; Antisense; GAAGCGAACTTTCGTCCCAGAAGTT
>probe:Drosophila_2:1636689_at:689:173; Interrogation_Position=835; Antisense; AAAGCCTTAGGCAGTTAGCCAGTTA
>probe:Drosophila_2:1636689_at:189:93; Interrogation_Position=902; Antisense; AGTTATCTGCAGTTATTTCCTAAAT

Paste this into a BLAST search page for me
ATGGCGTTACTCATTCTGGTATCCGGTATCCGCATTTGAGATGACAGCCATATTTGAACTCGACGGACTACCCCAACGGTCCAGGTCGATCTTTTGAGCAATGTGTAGCTCTCGAAAGCTGCCCAAAGCTGCCCATCCAGCAAATCTGTGGCTCCTCTGGTTTGTCGGATACTTAACTGGTTAAGTCAAAAGCCTGTCGAGAAAATACATTCATCGTCTTTACGATTACGAATGTAGCTGGTCTGCTCCCGCTCCCTTGGATTGACTACCATTTAGAAGCGAACTTTCGTCCCAGAAGTTAAAGCCTTAGGCAGTTAGCCAGTTAAGTTATCTGCAGTTATTTCCTAAAT

Full Affymetrix probeset data:

Annotations for 1636689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720