FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636690_at:

>probe:Drosophila_2:1636690_at:707:211; Interrogation_Position=1054; Antisense; AAGACACTCATGTACTTCCTACAGA
>probe:Drosophila_2:1636690_at:658:143; Interrogation_Position=1080; Antisense; ACTGCAGCAGCCTATAACCTTCATG
>probe:Drosophila_2:1636690_at:180:383; Interrogation_Position=1110; Antisense; GAACGTGTTTCCAATATCTGTGGGA
>probe:Drosophila_2:1636690_at:600:491; Interrogation_Position=1147; Antisense; GTCACAAAATTTTCGTTCTCCGTCT
>probe:Drosophila_2:1636690_at:356:87; Interrogation_Position=645; Antisense; AGTCAATTTCGTTTTGGTCCTGCGT
>probe:Drosophila_2:1636690_at:393:315; Interrogation_Position=693; Antisense; GCGCCTTCGACGTTTGGGAACTTAT
>probe:Drosophila_2:1636690_at:88:17; Interrogation_Position=781; Antisense; ATTTTGCGATTTGTTGACTGCCTGC
>probe:Drosophila_2:1636690_at:274:623; Interrogation_Position=803; Antisense; TGCGTCCTGTTATTTCTGGTACCAT
>probe:Drosophila_2:1636690_at:637:37; Interrogation_Position=826; Antisense; ATCTTCGTGCAATTCTTGGTTGTGG
>probe:Drosophila_2:1636690_at:175:725; Interrogation_Position=853; Antisense; TTGGTGCTGGGCTTTACCCTAATTA
>probe:Drosophila_2:1636690_at:141:603; Interrogation_Position=887; Antisense; TGTTCGCCAACTTGGGATCGGCCAT
>probe:Drosophila_2:1636690_at:632:581; Interrogation_Position=929; Antisense; TGGCCGCAGTGCTTCTAGAGACGAC
>probe:Drosophila_2:1636690_at:466:405; Interrogation_Position=951; Antisense; GACTCCCTTCTGCATATTGTGCAAT
>probe:Drosophila_2:1636690_at:464:375; Interrogation_Position=985; Antisense; GAAGACTGCTACAAGCTGGCCGATG

Paste this into a BLAST search page for me
AAGACACTCATGTACTTCCTACAGAACTGCAGCAGCCTATAACCTTCATGGAACGTGTTTCCAATATCTGTGGGAGTCACAAAATTTTCGTTCTCCGTCTAGTCAATTTCGTTTTGGTCCTGCGTGCGCCTTCGACGTTTGGGAACTTATATTTTGCGATTTGTTGACTGCCTGCTGCGTCCTGTTATTTCTGGTACCATATCTTCGTGCAATTCTTGGTTGTGGTTGGTGCTGGGCTTTACCCTAATTATGTTCGCCAACTTGGGATCGGCCATTGGCCGCAGTGCTTCTAGAGACGACGACTCCCTTCTGCATATTGTGCAATGAAGACTGCTACAAGCTGGCCGATG

Full Affymetrix probeset data:

Annotations for 1636690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720