FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636693_at:

>probe:Drosophila_2:1636693_at:708:465; Interrogation_Position=1496; Antisense; GATTGGATGCTAGCCAGACGCTACA
>probe:Drosophila_2:1636693_at:548:103; Interrogation_Position=1511; Antisense; AGACGCTACATATCGCTGCTGAACT
>probe:Drosophila_2:1636693_at:317:215; Interrogation_Position=1541; Antisense; AAGTTGTGGAACACGGTGGCCTCCG
>probe:Drosophila_2:1636693_at:312:35; Interrogation_Position=1573; Antisense; ATCACTGGGCCTGATTGGCATCATC
>probe:Drosophila_2:1636693_at:579:569; Interrogation_Position=1589; Antisense; GGCATCATCTATGTGGGCTGCGATT
>probe:Drosophila_2:1636693_at:621:517; Interrogation_Position=1618; Antisense; GTGGGTCACCTTTATGTTGGCCGGC
>probe:Drosophila_2:1636693_at:89:27; Interrogation_Position=1691; Antisense; ATAGCGCTCAGTCCACGATATGCAG
>probe:Drosophila_2:1636693_at:61:67; Interrogation_Position=1725; Antisense; ATGGCATCACCAATTCGGCGGCAAA
>probe:Drosophila_2:1636693_at:51:575; Interrogation_Position=1741; Antisense; GGCGGCAAATATCTGTGGCTTCCTG
>probe:Drosophila_2:1636693_at:614:599; Interrogation_Position=1774; Antisense; TGTCATCGGTCTAATCATCAATCAT
>probe:Drosophila_2:1636693_at:535:239; Interrogation_Position=1793; Antisense; AATCATCGCGAGACTCTGACACAGT
>probe:Drosophila_2:1636693_at:15:399; Interrogation_Position=1810; Antisense; GACACAGTGGCATCTGGTCTTCTGG
>probe:Drosophila_2:1636693_at:94:539; Interrogation_Position=1859; Antisense; GGTAACTTCATCTACCTGATCTTCG
>probe:Drosophila_2:1636693_at:585:707; Interrogation_Position=2037; Antisense; TTGGGCTCGAAGTTTTCCGGATGCA

Paste this into a BLAST search page for me
GATTGGATGCTAGCCAGACGCTACAAGACGCTACATATCGCTGCTGAACTAAGTTGTGGAACACGGTGGCCTCCGATCACTGGGCCTGATTGGCATCATCGGCATCATCTATGTGGGCTGCGATTGTGGGTCACCTTTATGTTGGCCGGCATAGCGCTCAGTCCACGATATGCAGATGGCATCACCAATTCGGCGGCAAAGGCGGCAAATATCTGTGGCTTCCTGTGTCATCGGTCTAATCATCAATCATAATCATCGCGAGACTCTGACACAGTGACACAGTGGCATCTGGTCTTCTGGGGTAACTTCATCTACCTGATCTTCGTTGGGCTCGAAGTTTTCCGGATGCA

Full Affymetrix probeset data:

Annotations for 1636693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720