FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636694_at:

>probe:Drosophila_2:1636694_at:553:563; Interrogation_Position=178; Antisense; GGAAGATGTCTAGCCGCTGGAATCC
>probe:Drosophila_2:1636694_at:64:585; Interrogation_Position=195; Antisense; TGGAATCCTGGCACCAAAGATCCTC
>probe:Drosophila_2:1636694_at:660:405; Interrogation_Position=273; Antisense; GACTGCCAAGCAGTTCATCCAGGAA
>probe:Drosophila_2:1636694_at:510:189; Interrogation_Position=297; Antisense; AACAGTGTCCACTCAGACGGAGGAT
>probe:Drosophila_2:1636694_at:14:169; Interrogation_Position=331; Antisense; AAATGTCTGCTGGAGTTCTGCACGC
>probe:Drosophila_2:1636694_at:23:705; Interrogation_Position=395; Antisense; TTATACATGGCGATCTCACCACATC
>probe:Drosophila_2:1636694_at:308:39; Interrogation_Position=417; Antisense; ATCTAACATCCTCATCAATCCGAAG
>probe:Drosophila_2:1636694_at:710:521; Interrogation_Position=443; Antisense; GTGGCGACTACGATGTCATTCTGAT
>probe:Drosophila_2:1636694_at:580:11; Interrogation_Position=460; Antisense; ATTCTGATTGACTTCGGCTTGAGCC
>probe:Drosophila_2:1636694_at:570:715; Interrogation_Position=472; Antisense; TTCGGCTTGAGCCACTACAATCAGG
>probe:Drosophila_2:1636694_at:282:159; Interrogation_Position=506; Antisense; ACAAGGGTGTGGATCTGTACGTCCT
>probe:Drosophila_2:1636694_at:270:587; Interrogation_Position=530; Antisense; TGGAGCGGGCGCTACTCAGTACGCA
>probe:Drosophila_2:1636694_at:5:387; Interrogation_Position=559; Antisense; GAACAGCCGTATATCTTCGAGCACG
>probe:Drosophila_2:1636694_at:709:71; Interrogation_Position=623; Antisense; AGGCAGTGCTCACCAAGTTCGAGGA

Paste this into a BLAST search page for me
GGAAGATGTCTAGCCGCTGGAATCCTGGAATCCTGGCACCAAAGATCCTCGACTGCCAAGCAGTTCATCCAGGAAAACAGTGTCCACTCAGACGGAGGATAAATGTCTGCTGGAGTTCTGCACGCTTATACATGGCGATCTCACCACATCATCTAACATCCTCATCAATCCGAAGGTGGCGACTACGATGTCATTCTGATATTCTGATTGACTTCGGCTTGAGCCTTCGGCTTGAGCCACTACAATCAGGACAAGGGTGTGGATCTGTACGTCCTTGGAGCGGGCGCTACTCAGTACGCAGAACAGCCGTATATCTTCGAGCACGAGGCAGTGCTCACCAAGTTCGAGGA

Full Affymetrix probeset data:

Annotations for 1636694_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720