FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636695_at:

>probe:Drosophila_2:1636695_at:65:79; Interrogation_Position=1672; Antisense; AGGATTGCCATCTACAAGGACTATA
>probe:Drosophila_2:1636695_at:615:557; Interrogation_Position=1689; Antisense; GGACTATAACCTGAGCTCCAAGCAG
>probe:Drosophila_2:1636695_at:280:217; Interrogation_Position=1719; Antisense; AAGTCTCTCGCCTCGGGAGATTATA
>probe:Drosophila_2:1636695_at:524:73; Interrogation_Position=1769; Antisense; AGGACAGGCATTTCGACCAGCTGAC
>probe:Drosophila_2:1636695_at:393:335; Interrogation_Position=1788; Antisense; GCTGACCAATCAGTGTGCCATCGAT
>probe:Drosophila_2:1636695_at:172:43; Interrogation_Position=1807; Antisense; ATCGATGCTTTCCTGGACTTCTAGC
>probe:Drosophila_2:1636695_at:503:673; Interrogation_Position=1828; Antisense; TAGCGCCCGAGCTGGAGGAGCCTTA
>probe:Drosophila_2:1636695_at:493:437; Interrogation_Position=1842; Antisense; GAGGAGCCTTACAAACAACATCACA
>probe:Drosophila_2:1636695_at:159:271; Interrogation_Position=1865; Antisense; CATCGACTTGATGTTCAGCCATATT
>probe:Drosophila_2:1636695_at:570:183; Interrogation_Position=1951; Antisense; AAAAGTCTTATACTCTCGACTCGAT
>probe:Drosophila_2:1636695_at:313:637; Interrogation_Position=1966; Antisense; TCGACTCGATTAACAAATGCCTTTA
>probe:Drosophila_2:1636695_at:412:515; Interrogation_Position=2004; Antisense; GTGTTTGCATTCTTTACAATCGAAC
>probe:Drosophila_2:1636695_at:190:715; Interrogation_Position=2167; Antisense; TTCGAATGCCATTTTTACACCGTTT
>probe:Drosophila_2:1636695_at:231:217; Interrogation_Position=2220; Antisense; AAGTAATTTTAGTCCAATGCGCCAA

Paste this into a BLAST search page for me
AGGATTGCCATCTACAAGGACTATAGGACTATAACCTGAGCTCCAAGCAGAAGTCTCTCGCCTCGGGAGATTATAAGGACAGGCATTTCGACCAGCTGACGCTGACCAATCAGTGTGCCATCGATATCGATGCTTTCCTGGACTTCTAGCTAGCGCCCGAGCTGGAGGAGCCTTAGAGGAGCCTTACAAACAACATCACACATCGACTTGATGTTCAGCCATATTAAAAGTCTTATACTCTCGACTCGATTCGACTCGATTAACAAATGCCTTTAGTGTTTGCATTCTTTACAATCGAACTTCGAATGCCATTTTTACACCGTTTAAGTAATTTTAGTCCAATGCGCCAA

Full Affymetrix probeset data:

Annotations for 1636695_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720