FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636698_at:

>probe:Drosophila_2:1636698_at:132:717; Interrogation_Position=334; Antisense; TTCCGCCGCGGATGGGTGGATAATC
>probe:Drosophila_2:1636698_at:503:495; Interrogation_Position=373; Antisense; GTCAGTGACCGAATGCCTAAGATCT
>probe:Drosophila_2:1636698_at:309:59; Interrogation_Position=449; Antisense; ATGATCCAGTAGAACGCAGCCTCGA
>probe:Drosophila_2:1636698_at:418:315; Interrogation_Position=467; Antisense; GCCTCGATCTTACGCTATTTTACAA
>probe:Drosophila_2:1636698_at:217:69; Interrogation_Position=497; Antisense; AGGCCTTGTGTGGTGAATTCTTCGC
>probe:Drosophila_2:1636698_at:337:235; Interrogation_Position=530; Antisense; AATCCAACTGTATGAGCACGGTGCT
>probe:Drosophila_2:1636698_at:186:235; Interrogation_Position=573; Antisense; AATGCCGGAGCTGGAACGTCTAATT
>probe:Drosophila_2:1636698_at:143:645; Interrogation_Position=609; Antisense; TCATCTGACAAATCTGTGGGTCTTC
>probe:Drosophila_2:1636698_at:154:695; Interrogation_Position=652; Antisense; TTTCCACGACTTCATAGCATATCCT
>probe:Drosophila_2:1636698_at:543:587; Interrogation_Position=710; Antisense; TGCGGAACTTACAGTTTCTTCCCCT
>probe:Drosophila_2:1636698_at:224:675; Interrogation_Position=734; Antisense; TAGCCGAACTGAACCTCCTGGACAA
>probe:Drosophila_2:1636698_at:179:691; Interrogation_Position=797; Antisense; TTTGGCCAAGTCTGCAGGTGCTCAA
>probe:Drosophila_2:1636698_at:232:633; Interrogation_Position=837; Antisense; TCCCGACCCGGCAATGATGCAATTA
>probe:Drosophila_2:1636698_at:444:433; Interrogation_Position=869; Antisense; GAGTGTTGCAACATACGGGCACCAA

Paste this into a BLAST search page for me
TTCCGCCGCGGATGGGTGGATAATCGTCAGTGACCGAATGCCTAAGATCTATGATCCAGTAGAACGCAGCCTCGAGCCTCGATCTTACGCTATTTTACAAAGGCCTTGTGTGGTGAATTCTTCGCAATCCAACTGTATGAGCACGGTGCTAATGCCGGAGCTGGAACGTCTAATTTCATCTGACAAATCTGTGGGTCTTCTTTCCACGACTTCATAGCATATCCTTGCGGAACTTACAGTTTCTTCCCCTTAGCCGAACTGAACCTCCTGGACAATTTGGCCAAGTCTGCAGGTGCTCAATCCCGACCCGGCAATGATGCAATTAGAGTGTTGCAACATACGGGCACCAA

Full Affymetrix probeset data:

Annotations for 1636698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720