FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636701_at:

>probe:Drosophila_2:1636701_at:388:181; Interrogation_Position=126; Antisense; AAAAATGCAGCAGTTCCAGAATCGG
>probe:Drosophila_2:1636701_at:453:53; Interrogation_Position=130; Antisense; ATGCAGCAGTTCCAGAATCGGAATC
>probe:Drosophila_2:1636701_at:443:367; Interrogation_Position=150; Antisense; GAATCGGAATCAGAGTCACCAGTAT
>probe:Drosophila_2:1636701_at:240:647; Interrogation_Position=165; Antisense; TCACCAGTATGGAAGGGACAGCCCT
>probe:Drosophila_2:1636701_at:360:559; Interrogation_Position=180; Antisense; GGACAGCCCTGAAGCGTCAGCAAAT
>probe:Drosophila_2:1636701_at:206:379; Interrogation_Position=190; Antisense; GAAGCGTCAGCAAATATTGGCGGAA
>probe:Drosophila_2:1636701_at:173:3; Interrogation_Position=205; Antisense; ATTGGCGGAAGGGTTGACACTCTAT
>probe:Drosophila_2:1636701_at:46:563; Interrogation_Position=211; Antisense; GGAAGGGTTGACACTCTATATGAGC
>probe:Drosophila_2:1636701_at:621:255; Interrogation_Position=222; Antisense; CACTCTATATGAGCGGAGGAGGACA
>probe:Drosophila_2:1636701_at:310:309; Interrogation_Position=267; Antisense; GAAAGCCGTGGTGGCGGTTAGACCA
>probe:Drosophila_2:1636701_at:368:645; Interrogation_Position=27; Antisense; TCAGGCGATTTCGAGGCGGGAAACT
>probe:Drosophila_2:1636701_at:485:695; Interrogation_Position=35; Antisense; TTTCGAGGCGGGAAACTGATCTCCA
>probe:Drosophila_2:1636701_at:313:177; Interrogation_Position=47; Antisense; AAACTGATCTCCAAAAGGGCTGGGC
>probe:Drosophila_2:1636701_at:105:313; Interrogation_Position=56; Antisense; TCCAAAAGGGCTGGGCGGAATCGAA

Paste this into a BLAST search page for me
AAAAATGCAGCAGTTCCAGAATCGGATGCAGCAGTTCCAGAATCGGAATCGAATCGGAATCAGAGTCACCAGTATTCACCAGTATGGAAGGGACAGCCCTGGACAGCCCTGAAGCGTCAGCAAATGAAGCGTCAGCAAATATTGGCGGAAATTGGCGGAAGGGTTGACACTCTATGGAAGGGTTGACACTCTATATGAGCCACTCTATATGAGCGGAGGAGGACAGAAAGCCGTGGTGGCGGTTAGACCATCAGGCGATTTCGAGGCGGGAAACTTTTCGAGGCGGGAAACTGATCTCCAAAACTGATCTCCAAAAGGGCTGGGCTCCAAAAGGGCTGGGCGGAATCGAA

Full Affymetrix probeset data:

Annotations for 1636701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720