FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636702_at:

>probe:Drosophila_2:1636702_at:273:73; Interrogation_Position=146; Antisense; AGGAATTCGGTGTGCTCAACCGCAC
>probe:Drosophila_2:1636702_at:295:331; Interrogation_Position=182; Antisense; GCGGACTCACCCAGGATAACTGTGT
>probe:Drosophila_2:1636702_at:490:195; Interrogation_Position=199; Antisense; AACTGTGTGTTCTACATCACCCATC
>probe:Drosophila_2:1636702_at:474:271; Interrogation_Position=220; Antisense; CATCGGTACGTTCGCAACTTCAAGA
>probe:Drosophila_2:1636702_at:450:607; Interrogation_Position=329; Antisense; TGAGATTGATTGGAGCCACCGCCGT
>probe:Drosophila_2:1636702_at:286:149; Interrogation_Position=422; Antisense; ACATCTGTCCCTGTGGAGAACCGAT
>probe:Drosophila_2:1636702_at:456:173; Interrogation_Position=468; Antisense; AAAGCACGATCAGTTCCTTCTGGAT
>probe:Drosophila_2:1636702_at:275:235; Interrogation_Position=503; Antisense; AATCCATCGAGAGACCAGCAAGCTA
>probe:Drosophila_2:1636702_at:693:199; Interrogation_Position=545; Antisense; AACCGCAGCGTTGGGACTTCCTGAA
>probe:Drosophila_2:1636702_at:344:145; Interrogation_Position=560; Antisense; ACTTCCTGAAGGTGGGTCTCGACCA
>probe:Drosophila_2:1636702_at:534:413; Interrogation_Position=580; Antisense; GACCAAATCGCAGACCGGGTGCAGT
>probe:Drosophila_2:1636702_at:423:509; Interrogation_Position=598; Antisense; GTGCAGTACCGCCTTCAGAAGGATG
>probe:Drosophila_2:1636702_at:113:395; Interrogation_Position=630; Antisense; GAAATCCATGCACGTGTCCACCTAA
>probe:Drosophila_2:1636702_at:675:561; Interrogation_Position=84; Antisense; GGAAGCTGCCAAGGGACATCCCGAT

Paste this into a BLAST search page for me
AGGAATTCGGTGTGCTCAACCGCACGCGGACTCACCCAGGATAACTGTGTAACTGTGTGTTCTACATCACCCATCCATCGGTACGTTCGCAACTTCAAGATGAGATTGATTGGAGCCACCGCCGTACATCTGTCCCTGTGGAGAACCGATAAAGCACGATCAGTTCCTTCTGGATAATCCATCGAGAGACCAGCAAGCTAAACCGCAGCGTTGGGACTTCCTGAAACTTCCTGAAGGTGGGTCTCGACCAGACCAAATCGCAGACCGGGTGCAGTGTGCAGTACCGCCTTCAGAAGGATGGAAATCCATGCACGTGTCCACCTAAGGAAGCTGCCAAGGGACATCCCGAT

Full Affymetrix probeset data:

Annotations for 1636702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720