FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636703_at:

>probe:Drosophila_2:1636703_at:10:223; Interrogation_Position=6267; Antisense; AAGGGAACTCGCATGTATTCAAGGA
>probe:Drosophila_2:1636703_at:386:87; Interrogation_Position=6328; Antisense; AGTAAATCCCCTCGATCAACAAAAT
>probe:Drosophila_2:1636703_at:548:549; Interrogation_Position=6355; Antisense; GGAGGGCTTCTCTGTTTCAAAACAA
>probe:Drosophila_2:1636703_at:600:121; Interrogation_Position=6497; Antisense; AGCGTAGCGGATTTTTCATTTGGAA
>probe:Drosophila_2:1636703_at:515:169; Interrogation_Position=6540; Antisense; AAAGGCCAATGATTCCGCGGGTGCA
>probe:Drosophila_2:1636703_at:236:301; Interrogation_Position=6554; Antisense; CCGCGGGTGCAGACTGTACTTGTAG
>probe:Drosophila_2:1636703_at:619:487; Interrogation_Position=6569; Antisense; GTACTTGTAGTACCCATTCTTACCA
>probe:Drosophila_2:1636703_at:525:211; Interrogation_Position=6599; Antisense; AAGACGTTCCCATTCTAAAATCTGA
>probe:Drosophila_2:1636703_at:21:181; Interrogation_Position=6615; Antisense; AAAATCTGAAGATCCTACCCGCTGT
>probe:Drosophila_2:1636703_at:390:55; Interrogation_Position=6686; Antisense; ATGACTCCAGTTTCCGGTTTCAGAA
>probe:Drosophila_2:1636703_at:199:725; Interrogation_Position=6717; Antisense; TTGCAGCTTGGCAGAAGTCCCGAAA
>probe:Drosophila_2:1636703_at:621:197; Interrogation_Position=6757; Antisense; AACGATTCTCAAAACCCAGGACAGG
>probe:Drosophila_2:1636703_at:400:527; Interrogation_Position=6806; Antisense; GGGTCAGTTACTGTCCATGTACCAG
>probe:Drosophila_2:1636703_at:532:487; Interrogation_Position=6824; Antisense; GTACCAGTGCCAATGGATTCTATAA

Paste this into a BLAST search page for me
AAGGGAACTCGCATGTATTCAAGGAAGTAAATCCCCTCGATCAACAAAATGGAGGGCTTCTCTGTTTCAAAACAAAGCGTAGCGGATTTTTCATTTGGAAAAAGGCCAATGATTCCGCGGGTGCACCGCGGGTGCAGACTGTACTTGTAGGTACTTGTAGTACCCATTCTTACCAAAGACGTTCCCATTCTAAAATCTGAAAAATCTGAAGATCCTACCCGCTGTATGACTCCAGTTTCCGGTTTCAGAATTGCAGCTTGGCAGAAGTCCCGAAAAACGATTCTCAAAACCCAGGACAGGGGGTCAGTTACTGTCCATGTACCAGGTACCAGTGCCAATGGATTCTATAA

Full Affymetrix probeset data:

Annotations for 1636703_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720