FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636704_at:

>probe:Drosophila_2:1636704_at:515:199; Interrogation_Position=2035; Antisense; AACGCTTTTCCAGCTCAGTTCCATT
>probe:Drosophila_2:1636704_at:241:343; Interrogation_Position=2038; Antisense; GCTTTTCCAGCTCAGTTCCATTGGT
>probe:Drosophila_2:1636704_at:631:717; Interrogation_Position=2042; Antisense; TTCCAGCTCAGTTCCATTGGTGGTG
>probe:Drosophila_2:1636704_at:249:3; Interrogation_Position=2057; Antisense; ATTGGTGGTGGGAGAAATGACATCA
>probe:Drosophila_2:1636704_at:64:387; Interrogation_Position=2070; Antisense; GAAATGACATCAATGCAATGTTGAA
>probe:Drosophila_2:1636704_at:434:355; Interrogation_Position=2084; Antisense; GCAATGTTGAATGTAATTAAACCGA
>probe:Drosophila_2:1636704_at:415:663; Interrogation_Position=2101; Antisense; TAAACCGATGTTATTACTGAGCAGC
>probe:Drosophila_2:1636704_at:689:131; Interrogation_Position=2104; Antisense; ACCGATGTTATTACTGAGCAGCAAA
>probe:Drosophila_2:1636704_at:515:707; Interrogation_Position=2114; Antisense; TTACTGAGCAGCAAAACGAATGTTT
>probe:Drosophila_2:1636704_at:553:29; Interrogation_Position=2127; Antisense; AAACGAATGTTTATTAACTGGTGAT
>probe:Drosophila_2:1636704_at:448:195; Interrogation_Position=2142; Antisense; AACTGGTGATGGATTCAAATGCTCA
>probe:Drosophila_2:1636704_at:642:533; Interrogation_Position=2146; Antisense; GGTGATGGATTCAAATGCTCAGTTT
>probe:Drosophila_2:1636704_at:693:255; Interrogation_Position=2157; Antisense; CAAATGCTCAGTTTGATTGAGTTGT
>probe:Drosophila_2:1636704_at:524:723; Interrogation_Position=2169; Antisense; TTGATTGAGTTGTAGTATGTGCCTA

Paste this into a BLAST search page for me
AACGCTTTTCCAGCTCAGTTCCATTGCTTTTCCAGCTCAGTTCCATTGGTTTCCAGCTCAGTTCCATTGGTGGTGATTGGTGGTGGGAGAAATGACATCAGAAATGACATCAATGCAATGTTGAAGCAATGTTGAATGTAATTAAACCGATAAACCGATGTTATTACTGAGCAGCACCGATGTTATTACTGAGCAGCAAATTACTGAGCAGCAAAACGAATGTTTAAACGAATGTTTATTAACTGGTGATAACTGGTGATGGATTCAAATGCTCAGGTGATGGATTCAAATGCTCAGTTTCAAATGCTCAGTTTGATTGAGTTGTTTGATTGAGTTGTAGTATGTGCCTA

Full Affymetrix probeset data:

Annotations for 1636704_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720