Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636705_at:

>probe:Drosophila_2:1636705_at:309:213; Interrogation_Position=1985; Antisense; AAGACGTTTAACAAGCAGCGCTACC
>probe:Drosophila_2:1636705_at:4:383; Interrogation_Position=2041; Antisense; GAACGCGTACGAGCTGCCGGAGAAA
>probe:Drosophila_2:1636705_at:589:683; Interrogation_Position=2077; Antisense; TATCACCGAGATACTTACCCAGCTA
>probe:Drosophila_2:1636705_at:233:97; Interrogation_Position=2121; Antisense; AGATCACCGACGTCAAGCGCATTAA
>probe:Drosophila_2:1636705_at:709:7; Interrogation_Position=2165; Antisense; ATTCGGATTGGGAAGCACGCTCTTA
>probe:Drosophila_2:1636705_at:287:113; Interrogation_Position=2178; Antisense; AGCACGCTCTTAAGATTTCACCACG
>probe:Drosophila_2:1636705_at:319:715; Interrogation_Position=2205; Antisense; TTCGTGATAGTAAAGCCGTTGCGTA
>probe:Drosophila_2:1636705_at:489:87; Interrogation_Position=2265; Antisense; AGTCCTATTTTCGTTAGCTGGCTTC
>probe:Drosophila_2:1636705_at:270:121; Interrogation_Position=2280; Antisense; AGCTGGCTTCTGTTTTTTGTATTCG
>probe:Drosophila_2:1636705_at:50:421; Interrogation_Position=2318; Antisense; GAGCATACGTCAGCGTTTTCTGCTA
>probe:Drosophila_2:1636705_at:452:699; Interrogation_Position=2333; Antisense; TTTTCTGCTAGACGATCCTTCATGA
>probe:Drosophila_2:1636705_at:426:673; Interrogation_Position=2376; Antisense; TACCCATGGGTATTGTGCTACAAAG
>probe:Drosophila_2:1636705_at:268:239; Interrogation_Position=2414; Antisense; AATCTATTCTTGACGTACTGTCCCA
>probe:Drosophila_2:1636705_at:580:487; Interrogation_Position=2428; Antisense; GTACTGTCCCATTTTCCGGATTATA

Paste this into a BLAST search page for me
AAGACGTTTAACAAGCAGCGCTACCGAACGCGTACGAGCTGCCGGAGAAATATCACCGAGATACTTACCCAGCTAAGATCACCGACGTCAAGCGCATTAAATTCGGATTGGGAAGCACGCTCTTAAGCACGCTCTTAAGATTTCACCACGTTCGTGATAGTAAAGCCGTTGCGTAAGTCCTATTTTCGTTAGCTGGCTTCAGCTGGCTTCTGTTTTTTGTATTCGGAGCATACGTCAGCGTTTTCTGCTATTTTCTGCTAGACGATCCTTCATGATACCCATGGGTATTGTGCTACAAAGAATCTATTCTTGACGTACTGTCCCAGTACTGTCCCATTTTCCGGATTATA

Full Affymetrix probeset data:

Annotations for 1636705_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime