Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636706_at:

>probe:Drosophila_2:1636706_at:625:547; Interrogation_Position=2136; Antisense; GGATGTCACTGATATGCCAAACTAC
>probe:Drosophila_2:1636706_at:344:425; Interrogation_Position=2185; Antisense; GAGACCACAATCGTTTCGGTTTCCG
>probe:Drosophila_2:1636706_at:162:185; Interrogation_Position=2249; Antisense; AAAAGGATCGCTTCCTGCGCAGAAT
>probe:Drosophila_2:1636706_at:288:523; Interrogation_Position=2309; Antisense; GGGCCAGCGGCAAGACTCTGCGTCA
>probe:Drosophila_2:1636706_at:229:425; Interrogation_Position=2371; Antisense; GAGAGGACACTCAGTGCCAGCAGCT
>probe:Drosophila_2:1636706_at:467:419; Interrogation_Position=2427; Antisense; GAGCTTCATCAAGTGGCAGCCGAAC
>probe:Drosophila_2:1636706_at:509:613; Interrogation_Position=2456; Antisense; TGAAGAAGGCCCTATTCTCGCGATC
>probe:Drosophila_2:1636706_at:563:687; Interrogation_Position=2468; Antisense; TATTCTCGCGATCCAGCAGCAAGCT
>probe:Drosophila_2:1636706_at:403:265; Interrogation_Position=2494; Antisense; CAGACGCCGGGCTGAGATCATAGTG
>probe:Drosophila_2:1636706_at:227:457; Interrogation_Position=2523; Antisense; GATAGCCATTCATTCGATTTCTCGA
>probe:Drosophila_2:1636706_at:51:461; Interrogation_Position=2538; Antisense; GATTTCTCGATTCTTTGATTCCTTG
>probe:Drosophila_2:1636706_at:230:693; Interrogation_Position=2551; Antisense; TTTGATTCCTTGTCGTGTGCCCAGT
>probe:Drosophila_2:1636706_at:23:517; Interrogation_Position=2565; Antisense; GTGTGCCCAGTCTAGTTGTGGCCGC
>probe:Drosophila_2:1636706_at:683:133; Interrogation_Position=2608; Antisense; ACCCTCCATGCCTAGTGATAATCTT

Paste this into a BLAST search page for me
GGATGTCACTGATATGCCAAACTACGAGACCACAATCGTTTCGGTTTCCGAAAAGGATCGCTTCCTGCGCAGAATGGGCCAGCGGCAAGACTCTGCGTCAGAGAGGACACTCAGTGCCAGCAGCTGAGCTTCATCAAGTGGCAGCCGAACTGAAGAAGGCCCTATTCTCGCGATCTATTCTCGCGATCCAGCAGCAAGCTCAGACGCCGGGCTGAGATCATAGTGGATAGCCATTCATTCGATTTCTCGAGATTTCTCGATTCTTTGATTCCTTGTTTGATTCCTTGTCGTGTGCCCAGTGTGTGCCCAGTCTAGTTGTGGCCGCACCCTCCATGCCTAGTGATAATCTT

Full Affymetrix probeset data:

Annotations for 1636706_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime