Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636708_at:

>probe:Drosophila_2:1636708_at:441:133; Interrogation_Position=1407; Antisense; ACGCCATCGTGCGAGAATCTGCAAA
>probe:Drosophila_2:1636708_at:630:33; Interrogation_Position=1462; Antisense; ATCACACGAAAAGCTACTCCTCAAA
>probe:Drosophila_2:1636708_at:102:343; Interrogation_Position=1500; Antisense; GAAACCTTAACTGCTGGGTTGTGTA
>probe:Drosophila_2:1636708_at:369:569; Interrogation_Position=1592; Antisense; TGTCTATTTAAATACCTTCCCTCTC
>probe:Drosophila_2:1636708_at:258:291; Interrogation_Position=1649; Antisense; CGTATAGAGCTGCTATGAGGCATCA
>probe:Drosophila_2:1636708_at:488:607; Interrogation_Position=1664; Antisense; TGAGGCATCAGGTTTTCCCCAATAA
>probe:Drosophila_2:1636708_at:101:481; Interrogation_Position=1690; Antisense; GTTTGGTAGCATTTTCATTTCGTAT
>probe:Drosophila_2:1636708_at:243:409; Interrogation_Position=1806; Antisense; GACGAAGGACTTTGCGTTTGTTTCA
>probe:Drosophila_2:1636708_at:113:329; Interrogation_Position=1819; Antisense; GCGTTTGTTTCATTTAGCAATCGGA
>probe:Drosophila_2:1636708_at:424:289; Interrogation_Position=1872; Antisense; CGGATACGACGCATCATCACATTTT
>probe:Drosophila_2:1636708_at:251:31; Interrogation_Position=1887; Antisense; ATCACATTTTTCTTAAGGACACGGA
>probe:Drosophila_2:1636708_at:288:657; Interrogation_Position=1900; Antisense; TAAGGACACGGAACGCATGGGCAGT
>probe:Drosophila_2:1636708_at:629:63; Interrogation_Position=1916; Antisense; ATGGGCAGTGGCGATATTCTGAATA
>probe:Drosophila_2:1636708_at:491:291; Interrogation_Position=1974; Antisense; CGTTTAGACGATGTAAGCACTCTCA

Paste this into a BLAST search page for me
ACGCCATCGTGCGAGAATCTGCAAAATCACACGAAAAGCTACTCCTCAAAGAAACCTTAACTGCTGGGTTGTGTATGTCTATTTAAATACCTTCCCTCTCCGTATAGAGCTGCTATGAGGCATCATGAGGCATCAGGTTTTCCCCAATAAGTTTGGTAGCATTTTCATTTCGTATGACGAAGGACTTTGCGTTTGTTTCAGCGTTTGTTTCATTTAGCAATCGGACGGATACGACGCATCATCACATTTTATCACATTTTTCTTAAGGACACGGATAAGGACACGGAACGCATGGGCAGTATGGGCAGTGGCGATATTCTGAATACGTTTAGACGATGTAAGCACTCTCA

Full Affymetrix probeset data:

Annotations for 1636708_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime