FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636709_at:

>probe:Drosophila_2:1636709_at:721:23; Interrogation_Position=1487; Antisense; AACGGTAACAGTGCCCATTTTTGAG
>probe:Drosophila_2:1636709_at:3:677; Interrogation_Position=1519; Antisense; TAGTATCCGATTCCGACGACGATGT
>probe:Drosophila_2:1636709_at:255:539; Interrogation_Position=1550; Antisense; GGTAGACGACTCCAATATCGACGTT
>probe:Drosophila_2:1636709_at:246:685; Interrogation_Position=1565; Antisense; TATCGACGTTTCATACGGCGACTCT
>probe:Drosophila_2:1636709_at:556:575; Interrogation_Position=1581; Antisense; GGCGACTCTGATATTGAACCGATTC
>probe:Drosophila_2:1636709_at:120:29; Interrogation_Position=1638; Antisense; ATAAGGGACCTACTGCGGACTGCAA
>probe:Drosophila_2:1636709_at:224:391; Interrogation_Position=1726; Antisense; GAAACGCCAATTCTGGCACAACCGA
>probe:Drosophila_2:1636709_at:302:357; Interrogation_Position=1741; Antisense; GCACAACCGAATTTGTCGCCGGGAG
>probe:Drosophila_2:1636709_at:415:633; Interrogation_Position=1756; Antisense; TCGCCGGGAGGTGCACTTACGTTAA
>probe:Drosophila_2:1636709_at:305:473; Interrogation_Position=1776; Antisense; GTTAACCGGCGCACCAAAATTGTCA
>probe:Drosophila_2:1636709_at:470:395; Interrogation_Position=1827; Antisense; GAAATCGGTCGCATGTTGCGTCAAT
>probe:Drosophila_2:1636709_at:443:137; Interrogation_Position=1870; Antisense; ACGAGTCTTCTGAGGATGTGCGAAC
>probe:Drosophila_2:1636709_at:41:151; Interrogation_Position=1973; Antisense; ACATTCTTGAGTTCTATTTCCAGGG
>probe:Drosophila_2:1636709_at:685:717; Interrogation_Position=1990; Antisense; TTCCAGGGTTTCGTACATTTATAGC

Paste this into a BLAST search page for me
AACGGTAACAGTGCCCATTTTTGAGTAGTATCCGATTCCGACGACGATGTGGTAGACGACTCCAATATCGACGTTTATCGACGTTTCATACGGCGACTCTGGCGACTCTGATATTGAACCGATTCATAAGGGACCTACTGCGGACTGCAAGAAACGCCAATTCTGGCACAACCGAGCACAACCGAATTTGTCGCCGGGAGTCGCCGGGAGGTGCACTTACGTTAAGTTAACCGGCGCACCAAAATTGTCAGAAATCGGTCGCATGTTGCGTCAATACGAGTCTTCTGAGGATGTGCGAACACATTCTTGAGTTCTATTTCCAGGGTTCCAGGGTTTCGTACATTTATAGC

Full Affymetrix probeset data:

Annotations for 1636709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720