FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636710_at:

>probe:Drosophila_2:1636710_at:286:35; Interrogation_Position=1017; Antisense; ATCTTCAGGATCTAAGCCGGCACAT
>probe:Drosophila_2:1636710_at:130:479; Interrogation_Position=1062; Antisense; GTTTAAGTGTTCCAGCTGCCCAAGG
>probe:Drosophila_2:1636710_at:480:623; Interrogation_Position=1078; Antisense; TGCCCAAGGACTTTTTCGCGGAAAT
>probe:Drosophila_2:1636710_at:196:475; Interrogation_Position=618; Antisense; GTTAAGGTGCCCATACTGCCAAAAG
>probe:Drosophila_2:1636710_at:716:245; Interrogation_Position=660; Antisense; AATTCTCAAGCAGCATTTGGCCACG
>probe:Drosophila_2:1636710_at:618:691; Interrogation_Position=675; Antisense; TTTGGCCACGCACACTGATGAAACG
>probe:Drosophila_2:1636710_at:546:391; Interrogation_Position=694; Antisense; GAAACGCAGTTCAAGTGTTCCCAGT
>probe:Drosophila_2:1636710_at:106:267; Interrogation_Position=715; Antisense; CAGTGCTCGAAGTCCTTTCAAGTCG
>probe:Drosophila_2:1636710_at:456:211; Interrogation_Position=773; Antisense; AAGAACGCCTCTTTACTTGTGGCCA
>probe:Drosophila_2:1636710_at:103:151; Interrogation_Position=787; Antisense; ACTTGTGGCCATTGCTCAAAGGACT
>probe:Drosophila_2:1636710_at:451:651; Interrogation_Position=802; Antisense; TCAAAGGACTTTGCGCTACATGCGT
>probe:Drosophila_2:1636710_at:347:667; Interrogation_Position=818; Antisense; TACATGCGTATCTCAAGCGACACCT
>probe:Drosophila_2:1636710_at:444:623; Interrogation_Position=928; Antisense; TGCCCAAAAACTTTCACTGACCGTT
>probe:Drosophila_2:1636710_at:501:657; Interrogation_Position=990; Antisense; TAAGCCATTGCTCGAAGGTCCTTGC

Paste this into a BLAST search page for me
ATCTTCAGGATCTAAGCCGGCACATGTTTAAGTGTTCCAGCTGCCCAAGGTGCCCAAGGACTTTTTCGCGGAAATGTTAAGGTGCCCATACTGCCAAAAGAATTCTCAAGCAGCATTTGGCCACGTTTGGCCACGCACACTGATGAAACGGAAACGCAGTTCAAGTGTTCCCAGTCAGTGCTCGAAGTCCTTTCAAGTCGAAGAACGCCTCTTTACTTGTGGCCAACTTGTGGCCATTGCTCAAAGGACTTCAAAGGACTTTGCGCTACATGCGTTACATGCGTATCTCAAGCGACACCTTGCCCAAAAACTTTCACTGACCGTTTAAGCCATTGCTCGAAGGTCCTTGC

Full Affymetrix probeset data:

Annotations for 1636710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720