FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636711_at:

>probe:Drosophila_2:1636711_at:644:525; Interrogation_Position=324; Antisense; GGGCAGAGCCCGGAGCGATCTACTA
>probe:Drosophila_2:1636711_at:372:179; Interrogation_Position=365; Antisense; AAACACTGTATGTACGACCAGCCTT
>probe:Drosophila_2:1636711_at:233:415; Interrogation_Position=380; Antisense; GACCAGCCTTACATGCATAACGACA
>probe:Drosophila_2:1636711_at:105:45; Interrogation_Position=404; Antisense; ATCGCCCTGGTGAAGCTTACCGAGA
>probe:Drosophila_2:1636711_at:512:423; Interrogation_Position=425; Antisense; GAGAACATCACCTTCAATGAGCTGA
>probe:Drosophila_2:1636711_at:579:231; Interrogation_Position=440; Antisense; AATGAGCTGACACAGCCGATCGCTT
>probe:Drosophila_2:1636711_at:82:451; Interrogation_Position=457; Antisense; GATCGCTTTGCCAACTAGACCGGTT
>probe:Drosophila_2:1636711_at:191:413; Interrogation_Position=474; Antisense; GACCGGTTCAACTCGGCGAAGAGAT
>probe:Drosophila_2:1636711_at:184:323; Interrogation_Position=489; Antisense; GCGAAGAGATCGTCCTCACGGGCTG
>probe:Drosophila_2:1636711_at:271:589; Interrogation_Position=543; Antisense; TGGAGGACCTGCACAAGCTGACCGT
>probe:Drosophila_2:1636711_at:155:315; Interrogation_Position=570; Antisense; GCCTTGTTCCTCTGGATGAGTGCTA
>probe:Drosophila_2:1636711_at:662:431; Interrogation_Position=587; Antisense; GAGTGCTATGAGACCTTCAACCGAA
>probe:Drosophila_2:1636711_at:232:443; Interrogation_Position=758; Antisense; GATGTGCAGGCCAATGTGTACTACT
>probe:Drosophila_2:1636711_at:366:515; Interrogation_Position=773; Antisense; GTGTACTACTACCTCGACTGGATTC

Paste this into a BLAST search page for me
GGGCAGAGCCCGGAGCGATCTACTAAAACACTGTATGTACGACCAGCCTTGACCAGCCTTACATGCATAACGACAATCGCCCTGGTGAAGCTTACCGAGAGAGAACATCACCTTCAATGAGCTGAAATGAGCTGACACAGCCGATCGCTTGATCGCTTTGCCAACTAGACCGGTTGACCGGTTCAACTCGGCGAAGAGATGCGAAGAGATCGTCCTCACGGGCTGTGGAGGACCTGCACAAGCTGACCGTGCCTTGTTCCTCTGGATGAGTGCTAGAGTGCTATGAGACCTTCAACCGAAGATGTGCAGGCCAATGTGTACTACTGTGTACTACTACCTCGACTGGATTC

Full Affymetrix probeset data:

Annotations for 1636711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720