FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636712_at:

>probe:Drosophila_2:1636712_at:238:503; Interrogation_Position=116; Antisense; GTCCCTTCCGAAAGCATGGAGTTAT
>probe:Drosophila_2:1636712_at:497:549; Interrogation_Position=133; Antisense; GGAGTTATTCCGTTGTCCACATACA
>probe:Drosophila_2:1636712_at:617:267; Interrogation_Position=156; Antisense; CATGCGGGTTTTCAAGATCGGCGAC
>probe:Drosophila_2:1636712_at:119:89; Interrogation_Position=170; Antisense; AGATCGGCGACATCGTTGACATTAA
>probe:Drosophila_2:1636712_at:170:533; Interrogation_Position=202; Antisense; GGTGCTGTACAGAAGGGTTTGCCCT
>probe:Drosophila_2:1636712_at:400:201; Interrogation_Position=246; Antisense; AACCGGGCGCATATTCAATGTGACT
>probe:Drosophila_2:1636712_at:713:229; Interrogation_Position=262; Antisense; AATGTGACTCAGCACGCCGTTGGTG
>probe:Drosophila_2:1636712_at:324:355; Interrogation_Position=311; Antisense; GCAAAATCCTTGCTAAGCGGGTCAA
>probe:Drosophila_2:1636712_at:288:325; Interrogation_Position=371; Antisense; GCGAAGATTTTTTGCGCCGCGTAAA
>probe:Drosophila_2:1636712_at:552:229; Interrogation_Position=437; Antisense; AATGGGTCAGTCTGAAGCGCCAGCC
>probe:Drosophila_2:1636712_at:144:711; Interrogation_Position=497; Antisense; TTGAAGAACCGATTGCTCTGGCCCC
>probe:Drosophila_2:1636712_at:61:581; Interrogation_Position=515; Antisense; TGGCCCCGATTCCATACGAATTCAT
>probe:Drosophila_2:1636712_at:638:313; Interrogation_Position=541; Antisense; GCCTAAAGGCATTTTACTGCTCGGA
>probe:Drosophila_2:1636712_at:320:193; Interrogation_Position=73; Antisense; AACTCAAAGGGCTATCGTCGCGGCA

Paste this into a BLAST search page for me
GTCCCTTCCGAAAGCATGGAGTTATGGAGTTATTCCGTTGTCCACATACACATGCGGGTTTTCAAGATCGGCGACAGATCGGCGACATCGTTGACATTAAGGTGCTGTACAGAAGGGTTTGCCCTAACCGGGCGCATATTCAATGTGACTAATGTGACTCAGCACGCCGTTGGTGGCAAAATCCTTGCTAAGCGGGTCAAGCGAAGATTTTTTGCGCCGCGTAAAAATGGGTCAGTCTGAAGCGCCAGCCTTGAAGAACCGATTGCTCTGGCCCCTGGCCCCGATTCCATACGAATTCATGCCTAAAGGCATTTTACTGCTCGGAAACTCAAAGGGCTATCGTCGCGGCA

Full Affymetrix probeset data:

Annotations for 1636712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720