FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636713_at:

>probe:Drosophila_2:1636713_at:479:703; Interrogation_Position=1043; Antisense; TTAGTTATGGTCCTGGTCGACGGCA
>probe:Drosophila_2:1636713_at:383:717; Interrogation_Position=1079; Antisense; TTCGTCCTGCTCGAGTGCGAGGATA
>probe:Drosophila_2:1636713_at:203:621; Interrogation_Position=1094; Antisense; TGCGAGGATACAAAGGGCCCACCAC
>probe:Drosophila_2:1636713_at:477:549; Interrogation_Position=1157; Antisense; GGAGGATGTCGAGCAGACACTGCCT
>probe:Drosophila_2:1636713_at:574:525; Interrogation_Position=1183; Antisense; GGGCAGACCAACAGCATAACTAATC
>probe:Drosophila_2:1636713_at:150:583; Interrogation_Position=1251; Antisense; TGGAAGCCACTTTGTTACCCGGTCA
>probe:Drosophila_2:1636713_at:202:593; Interrogation_Position=1324; Antisense; TGGGTTACGCCCAAGATGGTCCAGC
>probe:Drosophila_2:1636713_at:586:441; Interrogation_Position=1338; Antisense; GATGGTCCAGCATCCGGATATTTAA
>probe:Drosophila_2:1636713_at:688:271; Interrogation_Position=864; Antisense; CTTGGCAAGCAACAGTTCCTCGATG
>probe:Drosophila_2:1636713_at:188:447; Interrogation_Position=885; Antisense; GATGCCCAGCCATGGTTAGGTCCAT
>probe:Drosophila_2:1636713_at:551:703; Interrogation_Position=900; Antisense; TTAGGTCCATGTCCATAGGCCACTG
>probe:Drosophila_2:1636713_at:405:591; Interrogation_Position=923; Antisense; TGGTCCACTGACTCCTTGGTCACAA
>probe:Drosophila_2:1636713_at:100:591; Interrogation_Position=939; Antisense; TGGTCACAAGTGCACAAGCCTCTGG
>probe:Drosophila_2:1636713_at:668:323; Interrogation_Position=963; Antisense; GCGCTGCCTGCCAATTTGTGAGCAA

Paste this into a BLAST search page for me
TTAGTTATGGTCCTGGTCGACGGCATTCGTCCTGCTCGAGTGCGAGGATATGCGAGGATACAAAGGGCCCACCACGGAGGATGTCGAGCAGACACTGCCTGGGCAGACCAACAGCATAACTAATCTGGAAGCCACTTTGTTACCCGGTCATGGGTTACGCCCAAGATGGTCCAGCGATGGTCCAGCATCCGGATATTTAACTTGGCAAGCAACAGTTCCTCGATGGATGCCCAGCCATGGTTAGGTCCATTTAGGTCCATGTCCATAGGCCACTGTGGTCCACTGACTCCTTGGTCACAATGGTCACAAGTGCACAAGCCTCTGGGCGCTGCCTGCCAATTTGTGAGCAA

Full Affymetrix probeset data:

Annotations for 1636713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720