Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636716_at:

>probe:Drosophila_2:1636716_at:442:443; Interrogation_Position=1354; Antisense; GATGACAAGGAGACGCCGGCCACCA
>probe:Drosophila_2:1636716_at:100:317; Interrogation_Position=1368; Antisense; GCCGGCCACCATGAAGAACCTTATG
>probe:Drosophila_2:1636716_at:444:379; Interrogation_Position=1383; Antisense; GAACCTTATGGATATGCGATACCTG
>probe:Drosophila_2:1636716_at:536:623; Interrogation_Position=1397; Antisense; TGCGATACCTGGAGTGCTGCATCAA
>probe:Drosophila_2:1636716_at:550:719; Interrogation_Position=1439; Antisense; TTCCCAGTGTCCCAATGATGGCTAG
>probe:Drosophila_2:1636716_at:349:281; Interrogation_Position=1509; Antisense; CGGAACTCAGGCCATCATTATGACC
>probe:Drosophila_2:1636716_at:153:245; Interrogation_Position=1591; Antisense; AATTTCCTGCCGGAAAACTGCGCCG
>probe:Drosophila_2:1636716_at:97:719; Interrogation_Position=1627; Antisense; TTCGCCTATATACCCTTTAGCGCAG
>probe:Drosophila_2:1636716_at:472:699; Interrogation_Position=1642; Antisense; TTTAGCGCAGGACCGCGTAACTGCA
>probe:Drosophila_2:1636716_at:128:79; Interrogation_Position=1754; Antisense; AGGATCTCACGCTGCTGGGCGAGCT
>probe:Drosophila_2:1636716_at:195:327; Interrogation_Position=1772; Antisense; GCGAGCTCATTCTGCGGCCCAAGGA
>probe:Drosophila_2:1636716_at:626:315; Interrogation_Position=1799; Antisense; GCCTACGGGTTAAGATTACTCCAAG
>probe:Drosophila_2:1636716_at:213:225; Interrogation_Position=1829; Antisense; AAGGAGCTGATTTCCTGCCTCGGAA
>probe:Drosophila_2:1636716_at:126:385; Interrogation_Position=1866; Antisense; GAACTTCTATCCAAAGCCCAGTTGT

Paste this into a BLAST search page for me
GATGACAAGGAGACGCCGGCCACCAGCCGGCCACCATGAAGAACCTTATGGAACCTTATGGATATGCGATACCTGTGCGATACCTGGAGTGCTGCATCAATTCCCAGTGTCCCAATGATGGCTAGCGGAACTCAGGCCATCATTATGACCAATTTCCTGCCGGAAAACTGCGCCGTTCGCCTATATACCCTTTAGCGCAGTTTAGCGCAGGACCGCGTAACTGCAAGGATCTCACGCTGCTGGGCGAGCTGCGAGCTCATTCTGCGGCCCAAGGAGCCTACGGGTTAAGATTACTCCAAGAAGGAGCTGATTTCCTGCCTCGGAAGAACTTCTATCCAAAGCCCAGTTGT

Full Affymetrix probeset data:

Annotations for 1636716_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime