FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636717_at:

>probe:Drosophila_2:1636717_at:676:387; Interrogation_Position=1015; Antisense; GAAAAGTCCACCAAACGCAGGTCTG
>probe:Drosophila_2:1636717_at:463:173; Interrogation_Position=1027; Antisense; AAACGCAGGTCTGGCAGTCTGGGAC
>probe:Drosophila_2:1636717_at:356:429; Interrogation_Position=1059; Antisense; GATTTAGGAACCCACGTATGTAACT
>probe:Drosophila_2:1636717_at:121:93; Interrogation_Position=1181; Antisense; AGTTAATTCGTAGGCATTCCATATA
>probe:Drosophila_2:1636717_at:45:187; Interrogation_Position=722; Antisense; AACAATCAGGAACTGCGGCCGCAAG
>probe:Drosophila_2:1636717_at:541:103; Interrogation_Position=787; Antisense; AGACGCAGCGTGTATCGCCAGCAGC
>probe:Drosophila_2:1636717_at:36:115; Interrogation_Position=806; Antisense; AGCAGCAGAGCCTGAGCGACATTCT
>probe:Drosophila_2:1636717_at:673:401; Interrogation_Position=823; Antisense; GACATTCTGCCTTTCGACATCAGTC
>probe:Drosophila_2:1636717_at:62:499; Interrogation_Position=845; Antisense; GTCCTCCCGGACACATAGTCGATGA
>probe:Drosophila_2:1636717_at:367:605; Interrogation_Position=867; Antisense; TGATTTCTGCATCATTGCTTCCGAG
>probe:Drosophila_2:1636717_at:588:617; Interrogation_Position=882; Antisense; TGCTTCCGAGGCGAACAGCGTGAGC
>probe:Drosophila_2:1636717_at:306:69; Interrogation_Position=923; Antisense; AGGCGCGCAGCCTTAAGCAGTTAAT
>probe:Drosophila_2:1636717_at:222:5; Interrogation_Position=955; Antisense; ATTGGATCGGGCAGCTCGCCTGTGA
>probe:Drosophila_2:1636717_at:510:361; Interrogation_Position=986; Antisense; GCAAGGACCAGACAGCCAGTTCTCT

Paste this into a BLAST search page for me
GAAAAGTCCACCAAACGCAGGTCTGAAACGCAGGTCTGGCAGTCTGGGACGATTTAGGAACCCACGTATGTAACTAGTTAATTCGTAGGCATTCCATATAAACAATCAGGAACTGCGGCCGCAAGAGACGCAGCGTGTATCGCCAGCAGCAGCAGCAGAGCCTGAGCGACATTCTGACATTCTGCCTTTCGACATCAGTCGTCCTCCCGGACACATAGTCGATGATGATTTCTGCATCATTGCTTCCGAGTGCTTCCGAGGCGAACAGCGTGAGCAGGCGCGCAGCCTTAAGCAGTTAATATTGGATCGGGCAGCTCGCCTGTGAGCAAGGACCAGACAGCCAGTTCTCT

Full Affymetrix probeset data:

Annotations for 1636717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720