Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636719_s_at:

>probe:Drosophila_2:1636719_s_at:633:183; Interrogation_Position=150; Antisense; AAAAGTCTCGCCGTTGCTGCAATTC
>probe:Drosophila_2:1636719_s_at:248:487; Interrogation_Position=190; Antisense; GTAGCATTTGTGATGTCCTGGTCAA
>probe:Drosophila_2:1636719_s_at:271:505; Interrogation_Position=204; Antisense; GTCCTGGTCAAGTGCACTAATCAAA
>probe:Drosophila_2:1636719_s_at:174:697; Interrogation_Position=257; Antisense; TTTCGTCAGAAATCGCAGTGGTCAT
>probe:Drosophila_2:1636719_s_at:429:675; Interrogation_Position=281; Antisense; TAGCAGACAAGTTTCCCAAGGCGCA
>probe:Drosophila_2:1636719_s_at:239:227; Interrogation_Position=298; Antisense; AAGGCGCAGCATCACTACTTGGTGC
>probe:Drosophila_2:1636719_s_at:380:667; Interrogation_Position=313; Antisense; TACTTGGTGCTACCATTGGCCGACA
>probe:Drosophila_2:1636719_s_at:165:115; Interrogation_Position=343; Antisense; AGCATCTTTCACTTGAACCGGAGCC
>probe:Drosophila_2:1636719_s_at:223:127; Interrogation_Position=364; Antisense; AGCCATCTGTCGCTTTTGGAGGAGC
>probe:Drosophila_2:1636719_s_at:578:329; Interrogation_Position=435; Antisense; GCAGGACTTCAACGTGGGATTTCAC
>probe:Drosophila_2:1636719_s_at:82:19; Interrogation_Position=453; Antisense; ATTTCACGCGGAGCCGAGCATGCAA
>probe:Drosophila_2:1636719_s_at:500:355; Interrogation_Position=489; Antisense; GCACGTCATCTCCAAGGACTTCGTA
>probe:Drosophila_2:1636719_s_at:535:71; Interrogation_Position=503; Antisense; AGGACTTCGTATCAACAAGCCTGAA
>probe:Drosophila_2:1636719_s_at:71:377; Interrogation_Position=543; Antisense; GAACTCATTCAACACCGAGCTGTTT

Paste this into a BLAST search page for me
AAAAGTCTCGCCGTTGCTGCAATTCGTAGCATTTGTGATGTCCTGGTCAAGTCCTGGTCAAGTGCACTAATCAAATTTCGTCAGAAATCGCAGTGGTCATTAGCAGACAAGTTTCCCAAGGCGCAAAGGCGCAGCATCACTACTTGGTGCTACTTGGTGCTACCATTGGCCGACAAGCATCTTTCACTTGAACCGGAGCCAGCCATCTGTCGCTTTTGGAGGAGCGCAGGACTTCAACGTGGGATTTCACATTTCACGCGGAGCCGAGCATGCAAGCACGTCATCTCCAAGGACTTCGTAAGGACTTCGTATCAACAAGCCTGAAGAACTCATTCAACACCGAGCTGTTT

Full Affymetrix probeset data:

Annotations for 1636719_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime