FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636721_at:

>probe:Drosophila_2:1636721_at:423:345; Interrogation_Position=1867; Antisense; GCATATATTCGAGTAGTCACCACCA
>probe:Drosophila_2:1636721_at:491:137; Interrogation_Position=1891; Antisense; ACGTTTGCCGAGTTGGCTATCCCAA
>probe:Drosophila_2:1636721_at:399:655; Interrogation_Position=1929; Antisense; TAATATTATATTTCCTCGCGCCGAC
>probe:Drosophila_2:1636721_at:541:281; Interrogation_Position=1943; Antisense; CTCGCGCCGACTGATTTTACAAAAG
>probe:Drosophila_2:1636721_at:326:189; Interrogation_Position=2054; Antisense; AACATGTTCTCTTAGCAGTCATTCA
>probe:Drosophila_2:1636721_at:141:209; Interrogation_Position=2078; Antisense; AAGACTCAAGTGCTGCCTTTATGGG
>probe:Drosophila_2:1636721_at:10:317; Interrogation_Position=2092; Antisense; GCCTTTATGGGTTCAGAGCGGTGCA
>probe:Drosophila_2:1636721_at:105:535; Interrogation_Position=2111; Antisense; GGTGCAGTGCACAGATAATTCCAAA
>probe:Drosophila_2:1636721_at:45:655; Interrogation_Position=2126; Antisense; TAATTCCAAATCGAGCCCATAGACT
>probe:Drosophila_2:1636721_at:109:527; Interrogation_Position=2224; Antisense; GGGAATTTACAAACTCCTGCTTATT
>probe:Drosophila_2:1636721_at:39:179; Interrogation_Position=2234; Antisense; AAACTCCTGCTTATTTCCCATGGGT
>probe:Drosophila_2:1636721_at:354:503; Interrogation_Position=2257; Antisense; GTCCTGTGCGTATGTTTCTATTTGT
>probe:Drosophila_2:1636721_at:18:279; Interrogation_Position=2274; Antisense; CTATTTGTCTTAGCTCTTTATTGGC
>probe:Drosophila_2:1636721_at:210:667; Interrogation_Position=2305; Antisense; TAGTTACGGCGTAAATTCCACACAA

Paste this into a BLAST search page for me
GCATATATTCGAGTAGTCACCACCAACGTTTGCCGAGTTGGCTATCCCAATAATATTATATTTCCTCGCGCCGACCTCGCGCCGACTGATTTTACAAAAGAACATGTTCTCTTAGCAGTCATTCAAAGACTCAAGTGCTGCCTTTATGGGGCCTTTATGGGTTCAGAGCGGTGCAGGTGCAGTGCACAGATAATTCCAAATAATTCCAAATCGAGCCCATAGACTGGGAATTTACAAACTCCTGCTTATTAAACTCCTGCTTATTTCCCATGGGTGTCCTGTGCGTATGTTTCTATTTGTCTATTTGTCTTAGCTCTTTATTGGCTAGTTACGGCGTAAATTCCACACAA

Full Affymetrix probeset data:

Annotations for 1636721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720