FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636722_at:

>probe:Drosophila_2:1636722_at:664:341; Interrogation_Position=288; Antisense; GCTTAGAACCTACACAACCCATAAA
>probe:Drosophila_2:1636722_at:13:203; Interrogation_Position=344; Antisense; AACCATGACGGGTCGCGAATCCAAC
>probe:Drosophila_2:1636722_at:267:367; Interrogation_Position=360; Antisense; GAATCCAACCGCATCAAGGACGCTG
>probe:Drosophila_2:1636722_at:362:611; Interrogation_Position=383; Antisense; TGAAAAGAAGCGTGTCCTGGACTCC
>probe:Drosophila_2:1636722_at:178:349; Interrogation_Position=452; Antisense; GCAGGACAACTACCACGATGACCCA
>probe:Drosophila_2:1636722_at:83:375; Interrogation_Position=500; Antisense; GAAGTTGCCCAAATTCCAGGACAGC
>probe:Drosophila_2:1636722_at:721:221; Interrogation_Position=558; Antisense; AAGGGCGCCGAATACTTTCTCGTCA
>probe:Drosophila_2:1636722_at:527:107; Interrogation_Position=592; Antisense; AGAACTTCCAGCAACTGCTCGAGGA
>probe:Drosophila_2:1636722_at:401:251; Interrogation_Position=620; Antisense; CAAGGACAAGCAGCCCAACTACGAG
>probe:Drosophila_2:1636722_at:562:159; Interrogation_Position=665; Antisense; ACAAAAGCCACTGCGGCATTTCTGC
>probe:Drosophila_2:1636722_at:596:563; Interrogation_Position=699; Antisense; GGCAACTTCTCGTTGTACTCGTGCA
>probe:Drosophila_2:1636722_at:303:133; Interrogation_Position=723; Antisense; ACCGCCTGCGGAACGCGATACTGTT
>probe:Drosophila_2:1636722_at:102:457; Interrogation_Position=739; Antisense; GATACTGTTGCGTTAGATGCCTGCA
>probe:Drosophila_2:1636722_at:323:73; Interrogation_Position=772; Antisense; AGGACACGCGCTGCCTCAAGTGGAC

Paste this into a BLAST search page for me
GCTTAGAACCTACACAACCCATAAAAACCATGACGGGTCGCGAATCCAACGAATCCAACCGCATCAAGGACGCTGTGAAAAGAAGCGTGTCCTGGACTCCGCAGGACAACTACCACGATGACCCAGAAGTTGCCCAAATTCCAGGACAGCAAGGGCGCCGAATACTTTCTCGTCAAGAACTTCCAGCAACTGCTCGAGGACAAGGACAAGCAGCCCAACTACGAGACAAAAGCCACTGCGGCATTTCTGCGGCAACTTCTCGTTGTACTCGTGCAACCGCCTGCGGAACGCGATACTGTTGATACTGTTGCGTTAGATGCCTGCAAGGACACGCGCTGCCTCAAGTGGAC

Full Affymetrix probeset data:

Annotations for 1636722_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720