FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636724_at:

>probe:Drosophila_2:1636724_at:607:489; Interrogation_Position=518; Antisense; GTAACAATGCCCACTCCGGTGGTAG
>probe:Drosophila_2:1636724_at:363:289; Interrogation_Position=534; Antisense; CGGTGGTAGCCACCAAGCTAGTCAT
>probe:Drosophila_2:1636724_at:265:207; Interrogation_Position=548; Antisense; AAGCTAGTCATCGACCGTTCGGAGG
>probe:Drosophila_2:1636724_at:259:575; Interrogation_Position=571; Antisense; GGCGTCCTTTAGCAAGTACCTTGAT
>probe:Drosophila_2:1636724_at:235:375; Interrogation_Position=700; Antisense; GAAGATGCCGCCCATCCAGAAAGTG
>probe:Drosophila_2:1636724_at:368:515; Interrogation_Position=722; Antisense; GTGTCCCGCGAAGAGGATCCTACAA
>probe:Drosophila_2:1636724_at:379:345; Interrogation_Position=766; Antisense; GCATAATTGCCCAAAGCGACGCTGT
>probe:Drosophila_2:1636724_at:219:123; Interrogation_Position=780; Antisense; AGCGACGCTGTGAGTTTCAAAACCT
>probe:Drosophila_2:1636724_at:225:199; Interrogation_Position=810; Antisense; AACGAGTGCCGCATTCGGGAATGGT
>probe:Drosophila_2:1636724_at:441:369; Interrogation_Position=828; Antisense; GAATGGTCACCGAGGTGCGCGCTAA
>probe:Drosophila_2:1636724_at:147:323; Interrogation_Position=846; Antisense; GCGCTAATTTCACGGATCCACAATT
>probe:Drosophila_2:1636724_at:512:373; Interrogation_Position=893; Antisense; GAAGTTAAGCCCATACTCGTGCACG
>probe:Drosophila_2:1636724_at:692:137; Interrogation_Position=915; Antisense; ACGAGGAAGTCACTCCGTTTGCGGA
>probe:Drosophila_2:1636724_at:668:239; Interrogation_Position=948; Antisense; AATACGGCATCTACGGATCGGGAGA

Paste this into a BLAST search page for me
GTAACAATGCCCACTCCGGTGGTAGCGGTGGTAGCCACCAAGCTAGTCATAAGCTAGTCATCGACCGTTCGGAGGGGCGTCCTTTAGCAAGTACCTTGATGAAGATGCCGCCCATCCAGAAAGTGGTGTCCCGCGAAGAGGATCCTACAAGCATAATTGCCCAAAGCGACGCTGTAGCGACGCTGTGAGTTTCAAAACCTAACGAGTGCCGCATTCGGGAATGGTGAATGGTCACCGAGGTGCGCGCTAAGCGCTAATTTCACGGATCCACAATTGAAGTTAAGCCCATACTCGTGCACGACGAGGAAGTCACTCCGTTTGCGGAAATACGGCATCTACGGATCGGGAGA

Full Affymetrix probeset data:

Annotations for 1636724_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720