FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636725_at:

>probe:Drosophila_2:1636725_at:289:551; Interrogation_Position=213; Antisense; GGAGATGAAGCTATCCTTTGCAATA
>probe:Drosophila_2:1636725_at:208:277; Interrogation_Position=228; Antisense; CTTTGCAATAGCCAAATCCCAGGAC
>probe:Drosophila_2:1636725_at:347:569; Interrogation_Position=262; Antisense; GGCATTTGTTTGGAAACCGTCGTGA
>probe:Drosophila_2:1636725_at:62:329; Interrogation_Position=297; Antisense; GCGTGAATGTCGCTTTGGCATCCTG
>probe:Drosophila_2:1636725_at:571:729; Interrogation_Position=311; Antisense; TTGGCATCCTGCCTAAGTGCAAGCA
>probe:Drosophila_2:1636725_at:74:717; Interrogation_Position=356; Antisense; TTCGCAGATGGCGTCAGGCCGAGTA
>probe:Drosophila_2:1636725_at:111:649; Interrogation_Position=369; Antisense; TCAGGCCGAGTATATCGAGGACAAT
>probe:Drosophila_2:1636725_at:532:161; Interrogation_Position=389; Antisense; ACAATGTGAAGCGTGGTTGCCCCGA
>probe:Drosophila_2:1636725_at:624:597; Interrogation_Position=553; Antisense; TGTCCCTTTGGAACAAATTGCTTCT
>probe:Drosophila_2:1636725_at:626:247; Interrogation_Position=568; Antisense; AATTGCTTCTACAATCACCGTTCTC
>probe:Drosophila_2:1636725_at:663:649; Interrogation_Position=582; Antisense; TCACCGTTCTCTGGCGGGTGATAAC
>probe:Drosophila_2:1636725_at:213:533; Interrogation_Position=598; Antisense; GGTGATAACCGCATTCAACGGCATT
>probe:Drosophila_2:1636725_at:716:611; Interrogation_Position=669; Antisense; TGACATGGCATGTGACCGGTCGATC
>probe:Drosophila_2:1636725_at:581:535; Interrogation_Position=686; Antisense; GGTCGATCCCATTTCTCAGTGACTC

Paste this into a BLAST search page for me
GGAGATGAAGCTATCCTTTGCAATACTTTGCAATAGCCAAATCCCAGGACGGCATTTGTTTGGAAACCGTCGTGAGCGTGAATGTCGCTTTGGCATCCTGTTGGCATCCTGCCTAAGTGCAAGCATTCGCAGATGGCGTCAGGCCGAGTATCAGGCCGAGTATATCGAGGACAATACAATGTGAAGCGTGGTTGCCCCGATGTCCCTTTGGAACAAATTGCTTCTAATTGCTTCTACAATCACCGTTCTCTCACCGTTCTCTGGCGGGTGATAACGGTGATAACCGCATTCAACGGCATTTGACATGGCATGTGACCGGTCGATCGGTCGATCCCATTTCTCAGTGACTC

Full Affymetrix probeset data:

Annotations for 1636725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720