FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636726_at:

>probe:Drosophila_2:1636726_at:464:679; Interrogation_Position=1053; Antisense; TAGGGCTACGCTATCCTGTGATCAA
>probe:Drosophila_2:1636726_at:423:645; Interrogation_Position=1091; Antisense; TCTTGTCTTTCTAGTCATTCCGTAA
>probe:Drosophila_2:1636726_at:169:325; Interrogation_Position=551; Antisense; GCGAAACCAGTGACTCCGACGGGAT
>probe:Drosophila_2:1636726_at:648:85; Interrogation_Position=725; Antisense; AGTCGCGCAACATTCCCGAAGTGGA
>probe:Drosophila_2:1636726_at:690:567; Interrogation_Position=751; Antisense; GGCAGCGTCTTGAGCGACATCGAAC
>probe:Drosophila_2:1636726_at:249:383; Interrogation_Position=772; Antisense; GAACTGGAGGCTCAGTACTTGGCCA
>probe:Drosophila_2:1636726_at:318:489; Interrogation_Position=786; Antisense; GTACTTGGCCAGCTCGGTGGACAAT
>probe:Drosophila_2:1636726_at:533:439; Interrogation_Position=813; Antisense; GATGGAAAACCTGGGCAACCTGCTG
>probe:Drosophila_2:1636726_at:558:193; Interrogation_Position=855; Antisense; AACGGCCGACAACGTGGAGGTCCAT
>probe:Drosophila_2:1636726_at:415:271; Interrogation_Position=877; Antisense; CATCGCAACGCGGTCAACAAGCTGA
>probe:Drosophila_2:1636726_at:557:195; Interrogation_Position=895; Antisense; AAGCTGACGGACACTTTGGACGCGA
>probe:Drosophila_2:1636726_at:368:555; Interrogation_Position=912; Antisense; GGACGCGAATATCAAGTGCCAGTAC
>probe:Drosophila_2:1636726_at:483:265; Interrogation_Position=931; Antisense; CAGTACCAATTGCTGGCCAAGGCGG
>probe:Drosophila_2:1636726_at:445:499; Interrogation_Position=969; Antisense; GTCGATGAAACCCACAGAGCAGCTG

Paste this into a BLAST search page for me
TAGGGCTACGCTATCCTGTGATCAATCTTGTCTTTCTAGTCATTCCGTAAGCGAAACCAGTGACTCCGACGGGATAGTCGCGCAACATTCCCGAAGTGGAGGCAGCGTCTTGAGCGACATCGAACGAACTGGAGGCTCAGTACTTGGCCAGTACTTGGCCAGCTCGGTGGACAATGATGGAAAACCTGGGCAACCTGCTGAACGGCCGACAACGTGGAGGTCCATCATCGCAACGCGGTCAACAAGCTGAAAGCTGACGGACACTTTGGACGCGAGGACGCGAATATCAAGTGCCAGTACCAGTACCAATTGCTGGCCAAGGCGGGTCGATGAAACCCACAGAGCAGCTG

Full Affymetrix probeset data:

Annotations for 1636726_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720