Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636727_at:

>probe:Drosophila_2:1636727_at:392:29; Interrogation_Position=1341; Antisense; ATAAAGGCCACTGCGAGCGAATTGT
>probe:Drosophila_2:1636727_at:211:249; Interrogation_Position=1360; Antisense; AATTGTGTCGAAGGCTTGCGAGAAC
>probe:Drosophila_2:1636727_at:107:265; Interrogation_Position=1419; Antisense; CAGTTTAAGAATTGCCTACCGTATT
>probe:Drosophila_2:1636727_at:699:133; Interrogation_Position=1476; Antisense; ACCCACTTTGTGCACATACATGCAG
>probe:Drosophila_2:1636727_at:597:649; Interrogation_Position=1526; Antisense; TCACACGCATGAATAGGGTTAAGTT
>probe:Drosophila_2:1636727_at:603:501; Interrogation_Position=1586; Antisense; GTCGATTGTAATGACACCAGAAGAT
>probe:Drosophila_2:1636727_at:32:443; Interrogation_Position=1634; Antisense; GATGGTGGGCACAAACTGTTAATCA
>probe:Drosophila_2:1636727_at:599:193; Interrogation_Position=1647; Antisense; AACTGTTAATCATTGTCATCATGCA
>probe:Drosophila_2:1636727_at:228:497; Interrogation_Position=1661; Antisense; GTCATCATGCATTAATGCGAACGGA
>probe:Drosophila_2:1636727_at:531:173; Interrogation_Position=1690; Antisense; AAAGCTTAGGAGTACGATATCTGTT
>probe:Drosophila_2:1636727_at:324:459; Interrogation_Position=1705; Antisense; GATATCTGTTATATGCCAGCTGTGC
>probe:Drosophila_2:1636727_at:601:307; Interrogation_Position=1720; Antisense; CCAGCTGTGCGTCTGATTTACGATT
>probe:Drosophila_2:1636727_at:170:669; Interrogation_Position=1738; Antisense; TACGATTACGATTAAGCGAAGCAGT
>probe:Drosophila_2:1636727_at:478:489; Interrogation_Position=1779; Antisense; GTAAAATGCATAACCCCAATATAGT

Paste this into a BLAST search page for me
ATAAAGGCCACTGCGAGCGAATTGTAATTGTGTCGAAGGCTTGCGAGAACCAGTTTAAGAATTGCCTACCGTATTACCCACTTTGTGCACATACATGCAGTCACACGCATGAATAGGGTTAAGTTGTCGATTGTAATGACACCAGAAGATGATGGTGGGCACAAACTGTTAATCAAACTGTTAATCATTGTCATCATGCAGTCATCATGCATTAATGCGAACGGAAAAGCTTAGGAGTACGATATCTGTTGATATCTGTTATATGCCAGCTGTGCCCAGCTGTGCGTCTGATTTACGATTTACGATTACGATTAAGCGAAGCAGTGTAAAATGCATAACCCCAATATAGT

Full Affymetrix probeset data:

Annotations for 1636727_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime