FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636730_at:

>probe:Drosophila_2:1636730_at:460:615; Interrogation_Position=13; Antisense; TGCACGTCCCATCGAAGCTGAGTGT
>probe:Drosophila_2:1636730_at:227:369; Interrogation_Position=157; Antisense; GAATGCCCTGAAGCCATTGGTACAA
>probe:Drosophila_2:1636730_at:273:629; Interrogation_Position=266; Antisense; TCCAATCCGCGCCTGGAGAGAGTGA
>probe:Drosophila_2:1636730_at:259:287; Interrogation_Position=278; Antisense; CTGGAGAGAGTGAAATCGCGCTGCT
>probe:Drosophila_2:1636730_at:309:515; Interrogation_Position=35; Antisense; TGTCTAACCCTCCTTTAAGTGTCTA
>probe:Drosophila_2:1636730_at:336:433; Interrogation_Position=383; Antisense; GAGTGCTCCAGGTTCATTTGCCGCA
>probe:Drosophila_2:1636730_at:174:467; Interrogation_Position=434; Antisense; GTTGAAGAAGAGAAGGATCCCCTGT
>probe:Drosophila_2:1636730_at:549:307; Interrogation_Position=469; Antisense; CCAGATGTTCTTCAGCTAAGGCTTT
>probe:Drosophila_2:1636730_at:635:71; Interrogation_Position=487; Antisense; AGGCTTTACACAATCCAGCACTTAT
>probe:Drosophila_2:1636730_at:481:657; Interrogation_Position=511; Antisense; TAAAGTCGCGGTGCTTGTTAAATTT
>probe:Drosophila_2:1636730_at:280:515; Interrogation_Position=53; Antisense; GTGTCTAACTCAACTGGAACTCTCC
>probe:Drosophila_2:1636730_at:164:349; Interrogation_Position=547; Antisense; GCAGTACAAATTTGGGACGACACAA
>probe:Drosophila_2:1636730_at:394:561; Interrogation_Position=68; Antisense; GGAACTCTCCGATTTTCTATTTCTT
>probe:Drosophila_2:1636730_at:186:293; Interrogation_Position=77; Antisense; CGATTTTCTATTTCTTTCGCAGAGA

Paste this into a BLAST search page for me
TGCACGTCCCATCGAAGCTGAGTGTGAATGCCCTGAAGCCATTGGTACAATCCAATCCGCGCCTGGAGAGAGTGACTGGAGAGAGTGAAATCGCGCTGCTTGTCTAACCCTCCTTTAAGTGTCTAGAGTGCTCCAGGTTCATTTGCCGCAGTTGAAGAAGAGAAGGATCCCCTGTCCAGATGTTCTTCAGCTAAGGCTTTAGGCTTTACACAATCCAGCACTTATTAAAGTCGCGGTGCTTGTTAAATTTGTGTCTAACTCAACTGGAACTCTCCGCAGTACAAATTTGGGACGACACAAGGAACTCTCCGATTTTCTATTTCTTCGATTTTCTATTTCTTTCGCAGAGA

Full Affymetrix probeset data:

Annotations for 1636730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720