FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636731_at:

>probe:Drosophila_2:1636731_at:651:645; Interrogation_Position=1060; Antisense; TACGTTTTGGACTAATCCCGCCGTG
>probe:Drosophila_2:1636731_at:415:517; Interrogation_Position=1082; Antisense; GTGGTTGCTCATCCGTTTACAGAAA
>probe:Drosophila_2:1636731_at:542:527; Interrogation_Position=1131; Antisense; GGGAGAATCGTAGCGCAGCCAATTG
>probe:Drosophila_2:1636731_at:152:5; Interrogation_Position=1152; Antisense; ATTGTGCGCCAAGCCATTCATGAAG
>probe:Drosophila_2:1636731_at:243:13; Interrogation_Position=1167; Antisense; ATTCATGAAGGCATCGCGTACACGA
>probe:Drosophila_2:1636731_at:455:291; Interrogation_Position=1183; Antisense; CGTACACGACCACGCGGATGTTTTA
>probe:Drosophila_2:1636731_at:630:559; Interrogation_Position=1291; Antisense; GGAAATGTCCGTATCATCATCGAAT
>probe:Drosophila_2:1636731_at:424:277; Interrogation_Position=1343; Antisense; CTACGACGCGTTCCTTGAATATCTT
>probe:Drosophila_2:1636731_at:486:23; Interrogation_Position=1361; Antisense; ATATCTTAATTACACGCAACGCCAG
>probe:Drosophila_2:1636731_at:420:359; Interrogation_Position=1376; Antisense; GCAACGCCAGCACCGGGATTATTGG
>probe:Drosophila_2:1636731_at:670:249; Interrogation_Position=1427; Antisense; CAATGTTTGCTTCAGTTGCCAGGCA
>probe:Drosophila_2:1636731_at:280:101; Interrogation_Position=902; Antisense; AGAGTTTTTGAGACTGCCGCTGAAA
>probe:Drosophila_2:1636731_at:50:233; Interrogation_Position=929; Antisense; AATGCTATTGCTCATCCAATCGGAT
>probe:Drosophila_2:1636731_at:83:671; Interrogation_Position=968; Antisense; TACGGAGCTGGAGGTCTTCATGGCA

Paste this into a BLAST search page for me
TACGTTTTGGACTAATCCCGCCGTGGTGGTTGCTCATCCGTTTACAGAAAGGGAGAATCGTAGCGCAGCCAATTGATTGTGCGCCAAGCCATTCATGAAGATTCATGAAGGCATCGCGTACACGACGTACACGACCACGCGGATGTTTTAGGAAATGTCCGTATCATCATCGAATCTACGACGCGTTCCTTGAATATCTTATATCTTAATTACACGCAACGCCAGGCAACGCCAGCACCGGGATTATTGGCAATGTTTGCTTCAGTTGCCAGGCAAGAGTTTTTGAGACTGCCGCTGAAAAATGCTATTGCTCATCCAATCGGATTACGGAGCTGGAGGTCTTCATGGCA

Full Affymetrix probeset data:

Annotations for 1636731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720