FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636732_at:

>probe:Drosophila_2:1636732_at:379:381; Interrogation_Position=1186; Antisense; GAACCTGCTAGTGCACAAGCGGACT
>probe:Drosophila_2:1636732_at:1:119; Interrogation_Position=1230; Antisense; AGCTGCCCGAGGTACAGTGCCAGGA
>probe:Drosophila_2:1636732_at:92:599; Interrogation_Position=1269; Antisense; TGTCCGACGAGAACAGTTTGCGCAA
>probe:Drosophila_2:1636732_at:645:479; Interrogation_Position=1284; Antisense; GTTTGCGCAAGCACATGTACATGCA
>probe:Drosophila_2:1636732_at:703:59; Interrogation_Position=1298; Antisense; ATGTACATGCATCTGGATGCCGCCT
>probe:Drosophila_2:1636732_at:655:151; Interrogation_Position=1389; Antisense; ACATACGCTATCATCATCCGAAGGA
>probe:Drosophila_2:1636732_at:29:221; Interrogation_Position=1421; Antisense; AAGTGCACGCACTGCGCCAAGGAGT
>probe:Drosophila_2:1636732_at:150:213; Interrogation_Position=1448; Antisense; AAGAGCAGTCGCAGCCTCGAGGAGC
>probe:Drosophila_2:1636732_at:36:135; Interrogation_Position=1481; Antisense; ACGCATACCGGCCAGGATTTGTACG
>probe:Drosophila_2:1636732_at:222:77; Interrogation_Position=1494; Antisense; AGGATTTGTACGAGTGCGCCTTCTG
>probe:Drosophila_2:1636732_at:306:693; Interrogation_Position=1514; Antisense; TTCTGCGAGCGCACCTTCAAAAACT
>probe:Drosophila_2:1636732_at:113:159; Interrogation_Position=1632; Antisense; ACAAAGGTGACCTGCTGCTCGACGT
>probe:Drosophila_2:1636732_at:308:77; Interrogation_Position=1674; Antisense; AGGATATGAGCCACGTCATGGGTGC
>probe:Drosophila_2:1636732_at:275:507; Interrogation_Position=1695; Antisense; GTGCGGGCGACATGAATGACTGATT

Paste this into a BLAST search page for me
GAACCTGCTAGTGCACAAGCGGACTAGCTGCCCGAGGTACAGTGCCAGGATGTCCGACGAGAACAGTTTGCGCAAGTTTGCGCAAGCACATGTACATGCAATGTACATGCATCTGGATGCCGCCTACATACGCTATCATCATCCGAAGGAAAGTGCACGCACTGCGCCAAGGAGTAAGAGCAGTCGCAGCCTCGAGGAGCACGCATACCGGCCAGGATTTGTACGAGGATTTGTACGAGTGCGCCTTCTGTTCTGCGAGCGCACCTTCAAAAACTACAAAGGTGACCTGCTGCTCGACGTAGGATATGAGCCACGTCATGGGTGCGTGCGGGCGACATGAATGACTGATT

Full Affymetrix probeset data:

Annotations for 1636732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720