Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636736_s_at:

>probe:Drosophila_2:1636736_s_at:171:101; Interrogation_Position=418; Antisense; AGAGGACAACGGACGCATTTCGCTG
>probe:Drosophila_2:1636736_s_at:73:19; Interrogation_Position=434; Antisense; ATTTCGCTGGCCTATGAGAACCTGA
>probe:Drosophila_2:1636736_s_at:318:381; Interrogation_Position=451; Antisense; GAACCTGAAGACAATTCCGCGGCGA
>probe:Drosophila_2:1636736_s_at:304:581; Interrogation_Position=477; Antisense; TGGCCGACAAATTCGCAGCGCAGAC
>probe:Drosophila_2:1636736_s_at:13:325; Interrogation_Position=494; Antisense; GCGCAGACCAAGTTTCTCGATTTGA
>probe:Drosophila_2:1636736_s_at:419:605; Interrogation_Position=540; Antisense; TGAGATTTCTCTCCTTTTTCGAGGA
>probe:Drosophila_2:1636736_s_at:216:305; Interrogation_Position=552; Antisense; CCTTTTTCGAGGATCTGGACACTTT
>probe:Drosophila_2:1636736_s_at:543:585; Interrogation_Position=567; Antisense; TGGACACTTTAATCCTGGACCGCAA
>probe:Drosophila_2:1636736_s_at:217:585; Interrogation_Position=582; Antisense; TGGACCGCAACGTAAACCTGGACAT
>probe:Drosophila_2:1636736_s_at:404:187; Interrogation_Position=608; Antisense; AACACTTTTCCTTATTTGCCGAGCT
>probe:Drosophila_2:1636736_s_at:203:23; Interrogation_Position=669; Antisense; ATATAACCGATTGGATACACCGCAT
>probe:Drosophila_2:1636736_s_at:543:225; Interrogation_Position=768; Antisense; AAGGACCCCGCGAGTATATACTACA
>probe:Drosophila_2:1636736_s_at:489:481; Interrogation_Position=781; Antisense; GTATATACTACAGGTGCTTCCCCAG
>probe:Drosophila_2:1636736_s_at:489:343; Interrogation_Position=796; Antisense; GCTTCCCCAGCTAAAATATCTCGAT

Paste this into a BLAST search page for me
AGAGGACAACGGACGCATTTCGCTGATTTCGCTGGCCTATGAGAACCTGAGAACCTGAAGACAATTCCGCGGCGATGGCCGACAAATTCGCAGCGCAGACGCGCAGACCAAGTTTCTCGATTTGATGAGATTTCTCTCCTTTTTCGAGGACCTTTTTCGAGGATCTGGACACTTTTGGACACTTTAATCCTGGACCGCAATGGACCGCAACGTAAACCTGGACATAACACTTTTCCTTATTTGCCGAGCTATATAACCGATTGGATACACCGCATAAGGACCCCGCGAGTATATACTACAGTATATACTACAGGTGCTTCCCCAGGCTTCCCCAGCTAAAATATCTCGAT

Full Affymetrix probeset data:

Annotations for 1636736_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime