FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636738_at:

>probe:Drosophila_2:1636738_at:225:309; Interrogation_Position=117; Antisense; CCAGTGCGGCTATCCTGCGGCCAAG
>probe:Drosophila_2:1636738_at:88:57; Interrogation_Position=13; Antisense; ATGACCAAGGGAACCACTAGTTTTG
>probe:Drosophila_2:1636738_at:324:579; Interrogation_Position=135; Antisense; GGCCAAGACCCGAAGCTTCAACTGG
>probe:Drosophila_2:1636738_at:84:377; Interrogation_Position=146; Antisense; GAAGCTTCAACTGGTCCCGAAAGGC
>probe:Drosophila_2:1636738_at:298:629; Interrogation_Position=160; Antisense; TCCCGAAAGGCCAAGGGTCGCAAGG
>probe:Drosophila_2:1636738_at:88:367; Interrogation_Position=191; Antisense; GAACGGGAAGGATGCGGTACCTCAA
>probe:Drosophila_2:1636738_at:680:487; Interrogation_Position=207; Antisense; GTACCTCAAGAATCTGCGCCGTCGT
>probe:Drosophila_2:1636738_at:305:321; Interrogation_Position=222; Antisense; GCGCCGTCGTTTTCGCAACGGATTG
>probe:Drosophila_2:1636738_at:611:287; Interrogation_Position=247; Antisense; CGTGAAGGAGGTGCCGCTAAGAAAA
>probe:Drosophila_2:1636738_at:554:141; Interrogation_Position=28; Antisense; ACTAGTTTTGGAAAGCGCCACAACA
>probe:Drosophila_2:1636738_at:556:157; Interrogation_Position=47; Antisense; ACAACAAGACGCACACCATCTGTCG
>probe:Drosophila_2:1636738_at:278:41; Interrogation_Position=64; Antisense; ATCTGTCGCCGGTGCGGCAACTCGT
>probe:Drosophila_2:1636738_at:506:193; Interrogation_Position=82; Antisense; AACTCGTCGTACCATCTGCAGAAAT
>probe:Drosophila_2:1636738_at:385:351; Interrogation_Position=99; Antisense; GCAGAAATCGAAGTGCTCCCAGTGC

Paste this into a BLAST search page for me
CCAGTGCGGCTATCCTGCGGCCAAGATGACCAAGGGAACCACTAGTTTTGGGCCAAGACCCGAAGCTTCAACTGGGAAGCTTCAACTGGTCCCGAAAGGCTCCCGAAAGGCCAAGGGTCGCAAGGGAACGGGAAGGATGCGGTACCTCAAGTACCTCAAGAATCTGCGCCGTCGTGCGCCGTCGTTTTCGCAACGGATTGCGTGAAGGAGGTGCCGCTAAGAAAAACTAGTTTTGGAAAGCGCCACAACAACAACAAGACGCACACCATCTGTCGATCTGTCGCCGGTGCGGCAACTCGTAACTCGTCGTACCATCTGCAGAAATGCAGAAATCGAAGTGCTCCCAGTGC

Full Affymetrix probeset data:

Annotations for 1636738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720