Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636740_at:

>probe:Drosophila_2:1636740_at:562:557; Interrogation_Position=1024; Antisense; GGACAGGAGATTTCCACGCGACCCT
>probe:Drosophila_2:1636740_at:82:479; Interrogation_Position=1105; Antisense; GTTTCCGATGTTCCCAAATTGGTGG
>probe:Drosophila_2:1636740_at:451:333; Interrogation_Position=1185; Antisense; GCTGTCGCAGATCAACGAGGCATTC
>probe:Drosophila_2:1636740_at:226:251; Interrogation_Position=1221; Antisense; CAAGGGCGAGAGTATCCGATCCATT
>probe:Drosophila_2:1636740_at:103:665; Interrogation_Position=1293; Antisense; TACAAGTTGGCAATCGCATGCGATT
>probe:Drosophila_2:1636740_at:612:303; Interrogation_Position=773; Antisense; CCGGCAAGATCTACGGCATTGACAT
>probe:Drosophila_2:1636740_at:383:199; Interrogation_Position=799; Antisense; AATCCCGACAAGTTTGAGCTGGCCA
>probe:Drosophila_2:1636740_at:365:93; Interrogation_Position=827; Antisense; AGTTCGGATTCACCGACTTTGTCAA
>probe:Drosophila_2:1636740_at:670:721; Interrogation_Position=845; Antisense; TTGTCAACCCCAAGGATGTGGCCGA
>probe:Drosophila_2:1636740_at:358:63; Interrogation_Position=860; Antisense; ATGTGGCCGACAAGGGTTCGATCCA
>probe:Drosophila_2:1636740_at:724:529; Interrogation_Position=873; Antisense; GGGTTCGATCCAGAACTACCTGATC
>probe:Drosophila_2:1636740_at:619:461; Interrogation_Position=919; Antisense; GATTACACCTTCGAATGCATTGGCA
>probe:Drosophila_2:1636740_at:53:585; Interrogation_Position=939; Antisense; TGGCAATGTGAACACCATGCGCTCC
>probe:Drosophila_2:1636740_at:173:341; Interrogation_Position=964; Antisense; GCTTTGGAGGCCACACACAAGGGTT

Paste this into a BLAST search page for me
GGACAGGAGATTTCCACGCGACCCTGTTTCCGATGTTCCCAAATTGGTGGGCTGTCGCAGATCAACGAGGCATTCCAAGGGCGAGAGTATCCGATCCATTTACAAGTTGGCAATCGCATGCGATTCCGGCAAGATCTACGGCATTGACATAATCCCGACAAGTTTGAGCTGGCCAAGTTCGGATTCACCGACTTTGTCAATTGTCAACCCCAAGGATGTGGCCGAATGTGGCCGACAAGGGTTCGATCCAGGGTTCGATCCAGAACTACCTGATCGATTACACCTTCGAATGCATTGGCATGGCAATGTGAACACCATGCGCTCCGCTTTGGAGGCCACACACAAGGGTT

Full Affymetrix probeset data:

Annotations for 1636740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime