FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636742_at:

>probe:Drosophila_2:1636742_at:414:177; Interrogation_Position=2226; Antisense; AACACTGAACTATCCGTCGTTGTAA
>probe:Drosophila_2:1636742_at:145:491; Interrogation_Position=2247; Antisense; GTAAAGCTACCTTATCCACTACGAT
>probe:Drosophila_2:1636742_at:519:105; Interrogation_Position=2308; Antisense; AGACTATACACCTAGCTCCATATAC
>probe:Drosophila_2:1636742_at:32:595; Interrogation_Position=2381; Antisense; TGTGTGCGTGTGACTTCTGATTGAG
>probe:Drosophila_2:1636742_at:378:465; Interrogation_Position=2399; Antisense; GATTGAGTTGCCATTTGATTCCAAG
>probe:Drosophila_2:1636742_at:666:463; Interrogation_Position=2415; Antisense; GATTCCAAGTATTTTCGAGTGCTTA
>probe:Drosophila_2:1636742_at:103:487; Interrogation_Position=2452; Antisense; GTAGCTAGCCGTTAATGTTTGTATA
>probe:Drosophila_2:1636742_at:429:663; Interrogation_Position=2475; Antisense; TAAACTGTTTCATTGGTTTCCCACT
>probe:Drosophila_2:1636742_at:534:719; Interrogation_Position=2492; Antisense; TTCCCACTCCGCTTTATTCGATAAG
>probe:Drosophila_2:1636742_at:617:455; Interrogation_Position=2511; Antisense; GATAAGCTCGTTTTCTAGATTTTAG
>probe:Drosophila_2:1636742_at:594:89; Interrogation_Position=2580; Antisense; AGTTTACACCGTAGTCGAGGCGTCT
>probe:Drosophila_2:1636742_at:119:501; Interrogation_Position=2593; Antisense; GTCGAGGCGTCTTGAGTAGTTCTTT
>probe:Drosophila_2:1636742_at:27:27; Interrogation_Position=2653; Antisense; ATACCATGTCGAACCTACGAGTCTA
>probe:Drosophila_2:1636742_at:608:373; Interrogation_Position=2724; Antisense; GAAGCCGAACTTATGCAACCGAAAG

Paste this into a BLAST search page for me
AACACTGAACTATCCGTCGTTGTAAGTAAAGCTACCTTATCCACTACGATAGACTATACACCTAGCTCCATATACTGTGTGCGTGTGACTTCTGATTGAGGATTGAGTTGCCATTTGATTCCAAGGATTCCAAGTATTTTCGAGTGCTTAGTAGCTAGCCGTTAATGTTTGTATATAAACTGTTTCATTGGTTTCCCACTTTCCCACTCCGCTTTATTCGATAAGGATAAGCTCGTTTTCTAGATTTTAGAGTTTACACCGTAGTCGAGGCGTCTGTCGAGGCGTCTTGAGTAGTTCTTTATACCATGTCGAACCTACGAGTCTAGAAGCCGAACTTATGCAACCGAAAG

Full Affymetrix probeset data:

Annotations for 1636742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720