FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636745_at:

>probe:Drosophila_2:1636745_at:500:715; Interrogation_Position=2151; Antisense; TTCTGTTCTGTTTTGCATACCTTTT
>probe:Drosophila_2:1636745_at:603:615; Interrogation_Position=2164; Antisense; TGCATACCTTTTAACAACCTCTTTC
>probe:Drosophila_2:1636745_at:700:643; Interrogation_Position=2183; Antisense; TCTTTCCCTATCGTGCTATACTTAT
>probe:Drosophila_2:1636745_at:406:13; Interrogation_Position=2213; Antisense; CTTCTCTTACCCATTTAATCGATCG
>probe:Drosophila_2:1636745_at:693:493; Interrogation_Position=2396; Antisense; GTAATACCGATATTTAGCCCGCACG
>probe:Drosophila_2:1636745_at:642:259; Interrogation_Position=2417; Antisense; CACGGGACTGCGCTTCAGGAAGTTT
>probe:Drosophila_2:1636745_at:144:93; Interrogation_Position=2445; Antisense; AGTTAATATGCCGATTGCCAATTGC
>probe:Drosophila_2:1636745_at:50:349; Interrogation_Position=2468; Antisense; GCAGATTTTGCCGTAAGCTTTGAAC
>probe:Drosophila_2:1636745_at:501:21; Interrogation_Position=2543; Antisense; ATATATTGTGTGTACCTCCAGCTAG
>probe:Drosophila_2:1636745_at:639:487; Interrogation_Position=2554; Antisense; GTACCTCCAGCTAGTTTCAATTTTT
>probe:Drosophila_2:1636745_at:115:249; Interrogation_Position=2571; Antisense; CAATTTTTGTACTTGTCGACCGTGT
>probe:Drosophila_2:1636745_at:222:599; Interrogation_Position=2584; Antisense; TGTCGACCGTGTTTATGTTTAGTTC
>probe:Drosophila_2:1636745_at:373:13; Interrogation_Position=2656; Antisense; ATATCATTACTAAAGGCCGACCTGG
>probe:Drosophila_2:1636745_at:186:413; Interrogation_Position=2674; Antisense; GACCTGGGTCGAGAGATTATACTTA

Paste this into a BLAST search page for me
TTCTGTTCTGTTTTGCATACCTTTTTGCATACCTTTTAACAACCTCTTTCTCTTTCCCTATCGTGCTATACTTATCTTCTCTTACCCATTTAATCGATCGGTAATACCGATATTTAGCCCGCACGCACGGGACTGCGCTTCAGGAAGTTTAGTTAATATGCCGATTGCCAATTGCGCAGATTTTGCCGTAAGCTTTGAACATATATTGTGTGTACCTCCAGCTAGGTACCTCCAGCTAGTTTCAATTTTTCAATTTTTGTACTTGTCGACCGTGTTGTCGACCGTGTTTATGTTTAGTTCATATCATTACTAAAGGCCGACCTGGGACCTGGGTCGAGAGATTATACTTA

Full Affymetrix probeset data:

Annotations for 1636745_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720