Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636747_at:

>probe:Drosophila_2:1636747_at:350:623; Interrogation_Position=1988; Antisense; TCTCGATGACCTCCAATTTCTACGT
>probe:Drosophila_2:1636747_at:687:693; Interrogation_Position=2004; Antisense; TTTCTACGTCATGATGGCCATCTTC
>probe:Drosophila_2:1636747_at:407:591; Interrogation_Position=2068; Antisense; TGGTCCCTGATCATACCCAGTTATG
>probe:Drosophila_2:1636747_at:424:681; Interrogation_Position=2089; Antisense; TATGTGCCCCTGAAGAGATTGCCGG
>probe:Drosophila_2:1636747_at:187:607; Interrogation_Position=2135; Antisense; TGATGTCCGGCACCTTTTCGATGAT
>probe:Drosophila_2:1636747_at:710:701; Interrogation_Position=2149; Antisense; TTTTCGATGATCTTCGGACCGCTGA
>probe:Drosophila_2:1636747_at:229:555; Interrogation_Position=2164; Antisense; GGACCGCTGATTGGCTTAATCCGGG
>probe:Drosophila_2:1636747_at:640:707; Interrogation_Position=2179; Antisense; TTAATCCGGGATCACACCAGCTATG
>probe:Drosophila_2:1636747_at:192:277; Interrogation_Position=2244; Antisense; CTTTGCCGGCTGGTATCTGGAAGAT
>probe:Drosophila_2:1636747_at:443:41; Interrogation_Position=2258; Antisense; ATCTGGAAGATTTCATCCGCGCGCG
>probe:Drosophila_2:1636747_at:372:235; Interrogation_Position=2291; Antisense; AATCGCCACCGGTCAAGTCAATCAA
>probe:Drosophila_2:1636747_at:153:329; Interrogation_Position=2333; Antisense; GCGTAGTTTTACTCAGTGCCAGCGA
>probe:Drosophila_2:1636747_at:282:87; Interrogation_Position=2347; Antisense; AGTGCCAGCGAATTCCAGGACCAAC
>probe:Drosophila_2:1636747_at:343:689; Interrogation_Position=2408; Antisense; TATTCTTGTTATCGCATTTGCCCAG

Paste this into a BLAST search page for me
TCTCGATGACCTCCAATTTCTACGTTTTCTACGTCATGATGGCCATCTTCTGGTCCCTGATCATACCCAGTTATGTATGTGCCCCTGAAGAGATTGCCGGTGATGTCCGGCACCTTTTCGATGATTTTTCGATGATCTTCGGACCGCTGAGGACCGCTGATTGGCTTAATCCGGGTTAATCCGGGATCACACCAGCTATGCTTTGCCGGCTGGTATCTGGAAGATATCTGGAAGATTTCATCCGCGCGCGAATCGCCACCGGTCAAGTCAATCAAGCGTAGTTTTACTCAGTGCCAGCGAAGTGCCAGCGAATTCCAGGACCAACTATTCTTGTTATCGCATTTGCCCAG

Full Affymetrix probeset data:

Annotations for 1636747_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime