Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636750_s_at:

>probe:Drosophila_2:1636750_s_at:50:207; Interrogation_Position=111; Antisense; AAGCGACCGGCGAACAACATGGAGA
>probe:Drosophila_2:1636750_s_at:567:269; Interrogation_Position=128; Antisense; CATGGAGACCTATTTGACGGAGATC
>probe:Drosophila_2:1636750_s_at:442:407; Interrogation_Position=143; Antisense; GACGGAGATCAAACAGTTGCGCATA
>probe:Drosophila_2:1636750_s_at:650:93; Interrogation_Position=157; Antisense; AGTTGCGCATACCACGCCCGAAATT
>probe:Drosophila_2:1636750_s_at:578:133; Interrogation_Position=170; Antisense; ACGCCCGAAATTTGAGCCCAACAGT
>probe:Drosophila_2:1636750_s_at:695:609; Interrogation_Position=182; Antisense; TGAGCCCAACAGTTGCCATCAGCAG
>probe:Drosophila_2:1636750_s_at:718:271; Interrogation_Position=210; Antisense; CATCATGCGGTGACAGCCGTCGGAG
>probe:Drosophila_2:1636750_s_at:538:615; Interrogation_Position=262; Antisense; TGCACCACCGTCAGTGGCGACACTT
>probe:Drosophila_2:1636750_s_at:264:581; Interrogation_Position=276; Antisense; TGGCGACACTTTGTGCGACCCTTTA
>probe:Drosophila_2:1636750_s_at:104:135; Interrogation_Position=308; Antisense; ACGCGATTACCATCTGCCCATGGTG
>probe:Drosophila_2:1636750_s_at:269:573; Interrogation_Position=339; Antisense; GGCTCCTCCATGCACGACAAGATGT
>probe:Drosophila_2:1636750_s_at:306:461; Interrogation_Position=370; Antisense; GATTCACATTCAGTGGATGGGCAAA
>probe:Drosophila_2:1636750_s_at:134:179; Interrogation_Position=392; Antisense; AAACATGATGCATTACTCCCACACA
>probe:Drosophila_2:1636750_s_at:514:257; Interrogation_Position=411; Antisense; CACACATAGCCCCACATAATATACG

Paste this into a BLAST search page for me
AAGCGACCGGCGAACAACATGGAGACATGGAGACCTATTTGACGGAGATCGACGGAGATCAAACAGTTGCGCATAAGTTGCGCATACCACGCCCGAAATTACGCCCGAAATTTGAGCCCAACAGTTGAGCCCAACAGTTGCCATCAGCAGCATCATGCGGTGACAGCCGTCGGAGTGCACCACCGTCAGTGGCGACACTTTGGCGACACTTTGTGCGACCCTTTAACGCGATTACCATCTGCCCATGGTGGGCTCCTCCATGCACGACAAGATGTGATTCACATTCAGTGGATGGGCAAAAAACATGATGCATTACTCCCACACACACACATAGCCCCACATAATATACG

Full Affymetrix probeset data:

Annotations for 1636750_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime