FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636753_at:

>probe:Drosophila_2:1636753_at:310:545; Interrogation_Position=1012; Antisense; GGATCACACTTATCTTCGCCAGATA
>probe:Drosophila_2:1636753_at:57:635; Interrogation_Position=1027; Antisense; TCGCCAGATATTCCGCATACTTTTC
>probe:Drosophila_2:1636753_at:262:695; Interrogation_Position=1048; Antisense; TTTCCGCTCACTGAATCATCATTAC
>probe:Drosophila_2:1636753_at:626:685; Interrogation_Position=1080; Antisense; TATATGACTGGACTGCCTTGCAGCA
>probe:Drosophila_2:1636753_at:203:185; Interrogation_Position=1107; Antisense; AAAAGGATCAAATCTGCCGCAGCAG
>probe:Drosophila_2:1636753_at:385:333; Interrogation_Position=1231; Antisense; GCTGGATCGACTGCACAAAACTTCC
>probe:Drosophila_2:1636753_at:570:175; Interrogation_Position=1248; Antisense; AAACTTCCACCCAACAGGCAAAGTG
>probe:Drosophila_2:1636753_at:362:567; Interrogation_Position=1264; Antisense; GGCAAAGTGCTCTAATGGACATCTA
>probe:Drosophila_2:1636753_at:49:177; Interrogation_Position=1291; Antisense; AAACCGATATGATCGCATTGGCGAT
>probe:Drosophila_2:1636753_at:426:565; Interrogation_Position=858; Antisense; GGCAGGGTATTACGGCCGCCAACAA
>probe:Drosophila_2:1636753_at:684:137; Interrogation_Position=926; Antisense; ACGATCGCTCAGCTCTGCAAAGGAT
>probe:Drosophila_2:1636753_at:653:615; Interrogation_Position=941; Antisense; TGCAAAGGATTTCCCTCCGAATTTT
>probe:Drosophila_2:1636753_at:207:17; Interrogation_Position=961; Antisense; ATTTTGCCTGCTTATGACCTATGTC
>probe:Drosophila_2:1636753_at:696:727; Interrogation_Position=993; Antisense; TTGGTTTCAAGGAGCCGCCGGATCA

Paste this into a BLAST search page for me
GGATCACACTTATCTTCGCCAGATATCGCCAGATATTCCGCATACTTTTCTTTCCGCTCACTGAATCATCATTACTATATGACTGGACTGCCTTGCAGCAAAAAGGATCAAATCTGCCGCAGCAGGCTGGATCGACTGCACAAAACTTCCAAACTTCCACCCAACAGGCAAAGTGGGCAAAGTGCTCTAATGGACATCTAAAACCGATATGATCGCATTGGCGATGGCAGGGTATTACGGCCGCCAACAAACGATCGCTCAGCTCTGCAAAGGATTGCAAAGGATTTCCCTCCGAATTTTATTTTGCCTGCTTATGACCTATGTCTTGGTTTCAAGGAGCCGCCGGATCA

Full Affymetrix probeset data:

Annotations for 1636753_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720