FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636756_at:

>probe:Drosophila_2:1636756_at:631:99; Interrogation_Position=141; Antisense; AGAGTACAACGTCCTTTGACTCCAG
>probe:Drosophila_2:1636756_at:718:153; Interrogation_Position=167; Antisense; ACAGGCTCCTACACTTATACAGACG
>probe:Drosophila_2:1636756_at:302:155; Interrogation_Position=185; Antisense; ACAGACGCCACTTCTTTGCGAAAGA
>probe:Drosophila_2:1636756_at:75:551; Interrogation_Position=235; Antisense; GGAGTTCATGAAGACCGCCAAGGCT
>probe:Drosophila_2:1636756_at:528:215; Interrogation_Position=318; Antisense; AAGATTTCTTCAATTTCGAGCTCAA
>probe:Drosophila_2:1636756_at:373:81; Interrogation_Position=35; Antisense; AGTAAAACTTCCGTTGCTTCCAGCA
>probe:Drosophila_2:1636756_at:487:641; Interrogation_Position=351; Antisense; TCTGGGATGCGATTGCCGATGAAAT
>probe:Drosophila_2:1636756_at:196:265; Interrogation_Position=381; Antisense; CGGACTCGCCATCTGGGTTTTGGAA
>probe:Drosophila_2:1636756_at:277:273; Interrogation_Position=407; Antisense; CATATGATTCACAAGCTTCGCTATA
>probe:Drosophila_2:1636756_at:573:157; Interrogation_Position=466; Antisense; AAAGTTTTCGGGTGAATCGCCGCAG
>probe:Drosophila_2:1636756_at:647:235; Interrogation_Position=480; Antisense; AATCGCCGCAGCCAAAACTATTTTA
>probe:Drosophila_2:1636756_at:152:719; Interrogation_Position=52; Antisense; TTCCAGCACGGATTTCTTTTCACTC
>probe:Drosophila_2:1636756_at:133:643; Interrogation_Position=75; Antisense; TCTCCGACAAGCCATCGTTGGGAAG
>probe:Drosophila_2:1636756_at:197:375; Interrogation_Position=99; Antisense; GAAGACGAGCCCTACTGGCTGCAAA

Paste this into a BLAST search page for me
AGAGTACAACGTCCTTTGACTCCAGACAGGCTCCTACACTTATACAGACGACAGACGCCACTTCTTTGCGAAAGAGGAGTTCATGAAGACCGCCAAGGCTAAGATTTCTTCAATTTCGAGCTCAAAGTAAAACTTCCGTTGCTTCCAGCATCTGGGATGCGATTGCCGATGAAATCGGACTCGCCATCTGGGTTTTGGAACATATGATTCACAAGCTTCGCTATAAAAGTTTTCGGGTGAATCGCCGCAGAATCGCCGCAGCCAAAACTATTTTATTCCAGCACGGATTTCTTTTCACTCTCTCCGACAAGCCATCGTTGGGAAGGAAGACGAGCCCTACTGGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1636756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720