FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636757_at:

>probe:Drosophila_2:1636757_at:215:119; Interrogation_Position=394; Antisense; AGCCACCGAAATTCCCAACGAGGAT
>probe:Drosophila_2:1636757_at:119:389; Interrogation_Position=456; Antisense; GAAAACCCGTACTCGTGCTCATTCG
>probe:Drosophila_2:1636757_at:81:621; Interrogation_Position=471; Antisense; TGCTCATTCGTGATGCCCTGAAGAA
>probe:Drosophila_2:1636757_at:140:615; Interrogation_Position=489; Antisense; TGAAGAAGGTCACCACCGATCTGCC
>probe:Drosophila_2:1636757_at:454:79; Interrogation_Position=522; Antisense; AGGTGGCTAACAATGCTCTGCAGTA
>probe:Drosophila_2:1636757_at:365:617; Interrogation_Position=540; Antisense; TGCAGTACTTCCAGCAGTTCGAACA
>probe:Drosophila_2:1636757_at:672:93; Interrogation_Position=555; Antisense; AGTTCGAACACTTCATCCAACAGGC
>probe:Drosophila_2:1636757_at:122:145; Interrogation_Position=620; Antisense; ACTCCATCTACAGTTATTCCCGAAA
>probe:Drosophila_2:1636757_at:40:97; Interrogation_Position=696; Antisense; AGATCCCGGAAGTTGAGGTCCCTGC
>probe:Drosophila_2:1636757_at:342:633; Interrogation_Position=714; Antisense; TCCCTGCTGTCGTTTCCGAAAAGGA
>probe:Drosophila_2:1636757_at:161:425; Interrogation_Position=737; Antisense; GAGACTCTGGCAGTGGAACCCATGA
>probe:Drosophila_2:1636757_at:707:213; Interrogation_Position=761; Antisense; AAGATGGAGGAGTCTGCCCCATCGA
>probe:Drosophila_2:1636757_at:686:495; Interrogation_Position=797; Antisense; GTCAGCAATGCTGTCTAGTCTAGAA
>probe:Drosophila_2:1636757_at:535:649; Interrogation_Position=829; Antisense; TCAACACATCATTCCTCAGCTATTT

Paste this into a BLAST search page for me
AGCCACCGAAATTCCCAACGAGGATGAAAACCCGTACTCGTGCTCATTCGTGCTCATTCGTGATGCCCTGAAGAATGAAGAAGGTCACCACCGATCTGCCAGGTGGCTAACAATGCTCTGCAGTATGCAGTACTTCCAGCAGTTCGAACAAGTTCGAACACTTCATCCAACAGGCACTCCATCTACAGTTATTCCCGAAAAGATCCCGGAAGTTGAGGTCCCTGCTCCCTGCTGTCGTTTCCGAAAAGGAGAGACTCTGGCAGTGGAACCCATGAAAGATGGAGGAGTCTGCCCCATCGAGTCAGCAATGCTGTCTAGTCTAGAATCAACACATCATTCCTCAGCTATTT

Full Affymetrix probeset data:

Annotations for 1636757_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720