Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636759_at:

>probe:Drosophila_2:1636759_at:199:679; Interrogation_Position=1614; Antisense; TAGGAATCCGGCGTTTCTACTTCAA
>probe:Drosophila_2:1636759_at:582:85; Interrogation_Position=1648; Antisense; AGTGACCACGGATTGGCATCGCAAC
>probe:Drosophila_2:1636759_at:426:347; Interrogation_Position=1663; Antisense; GCATCGCAACTACTGGAAGGTCTTT
>probe:Drosophila_2:1636759_at:694:535; Interrogation_Position=1681; Antisense; GGTCTTTAACGTCCTGTACTACGCG
>probe:Drosophila_2:1636759_at:630:667; Interrogation_Position=1697; Antisense; TACTACGCGGGCTATGTGGTCATCT
>probe:Drosophila_2:1636759_at:127:283; Interrogation_Position=1741; Antisense; CCTTACTTTAACTTTGGGCCTGCAG
>probe:Drosophila_2:1636759_at:122:265; Interrogation_Position=1763; Antisense; CAGATCGGACTTACGTTGGCGGTTC
>probe:Drosophila_2:1636759_at:151:541; Interrogation_Position=1796; Antisense; GGATTTCTCGTCTGGTTGTAGTGGC
>probe:Drosophila_2:1636759_at:721:465; Interrogation_Position=1810; Antisense; GTTGTAGTGGCTGCATCCGAATCGC
>probe:Drosophila_2:1636759_at:212:543; Interrogation_Position=1843; Antisense; GGATTGTGCAATATTTCCGCTCCAA
>probe:Drosophila_2:1636759_at:717:219; Interrogation_Position=1866; Antisense; AAGTGCGATGCTACCACACATGGTT
>probe:Drosophila_2:1636759_at:713:153; Interrogation_Position=1881; Antisense; ACACATGGTTGTTCGTTTCCATCCG
>probe:Drosophila_2:1636759_at:600:479; Interrogation_Position=1895; Antisense; GTTTCCATCCGTAGTTTGTTCTAGT
>probe:Drosophila_2:1636759_at:526:709; Interrogation_Position=1941; Antisense; TTAAGTTCTTTCACACAAGCCAAGT

Paste this into a BLAST search page for me
TAGGAATCCGGCGTTTCTACTTCAAAGTGACCACGGATTGGCATCGCAACGCATCGCAACTACTGGAAGGTCTTTGGTCTTTAACGTCCTGTACTACGCGTACTACGCGGGCTATGTGGTCATCTCCTTACTTTAACTTTGGGCCTGCAGCAGATCGGACTTACGTTGGCGGTTCGGATTTCTCGTCTGGTTGTAGTGGCGTTGTAGTGGCTGCATCCGAATCGCGGATTGTGCAATATTTCCGCTCCAAAAGTGCGATGCTACCACACATGGTTACACATGGTTGTTCGTTTCCATCCGGTTTCCATCCGTAGTTTGTTCTAGTTTAAGTTCTTTCACACAAGCCAAGT

Full Affymetrix probeset data:

Annotations for 1636759_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime